View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-7 (Length: 410)
Name: NF0796-Insertion-7
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796-Insertion-7 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 7 - 410
Target Start/End: Original strand, 42936442 - 42936845
Alignment:
Q |
7 |
atgaataagaagaacatgctcctacagagttgtttgattcataaatggaagcagaaacaccaaaatctgcaagtttcactaatccatttgagtcaacaag |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42936442 |
atgaataagaagaacatgctcctacagagttgtttgattcataaatggaagcagaaacaccaaaatctgcaagtttcactaatccatttgagtcaacaag |
42936541 |
T |
 |
Q |
107 |
gatgttaccggatttgatatctctatgaagatgtccttgtccatgaaggtaagaaagagcattgagagtgtctttgagaataacagctatggattgttct |
206 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42936542 |
gatgttaccagatttgatatctctatgaagatgtccttgtccatgaaggtaagaaagagcattgagagtgtctttgagaataacagctatggattgttct |
42936641 |
T |
 |
Q |
207 |
gttaagccgttttggaaagagtgagagattatggattgcaatgaacctccagccatgaatggcataaccacccaaagacggttgtcaacggtgaaagaac |
306 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42936642 |
gttaagccgttttggaaagagtgagagataatggattgtaatgaacctccagccatgaatggcataaccacccaaagacggttgtcaacggtgaaagaac |
42936741 |
T |
 |
Q |
307 |
agtgagctttgaggatgttggggtgggaaagaagtgataatgtctttgcttcacgtctaacatcgtcaaggtcggggcgcgaacgatccaagtctatgga |
406 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42936742 |
agtgagctttgaggatgttggggtgggaaagaagtgataatgtctttgcttcacgtctaacatcgtcaaggtcggggcgcgaacgatccaagtctatgga |
42936841 |
T |
 |
Q |
407 |
tttg |
410 |
Q |
|
|
|||| |
|
|
T |
42936842 |
tttg |
42936845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4725 times since January 2019
Visitors: 5752