View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_high_38 (Length: 268)
Name: NF0796_high_38
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 16169193 - 16169414
Alignment:
| Q |
18 |
cattaaagaatatacttttaggatattatttctaatgtattgcatgatatactgtgaacctggccattagccccactgtcctctttacttcattgcatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16169193 |
cattaaagaatatacttttaggatattatttctaatgtattgcatgatatactgtgaacctgcccattagccccactgtcctctttaattcattgcatgt |
16169292 |
T |
 |
| Q |
118 |
tccccacgtgatccttgatctacacttggatcctattaacacaaagagacaaaaccatagtttcattgttcactatcaatcacatatcacttcaatttca |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16169293 |
tccccacgtgatccttgatccacacttggatcctattaacacaaagagacaaaaccatagtttcattgttcactatcaatcacatatcacttcaatttca |
16169392 |
T |
 |
| Q |
218 |
ctctattaagacactaaggttc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16169393 |
ctctattaagacactaaggttc |
16169414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University