View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_14 (Length: 610)
Name: NF0796_low_14
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 130 - 475
Target Start/End: Original strand, 35915907 - 35916252
Alignment:
| Q |
130 |
tattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915907 |
tattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggt |
35916006 |
T |
|
| Q |
230 |
cagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcat |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916007 |
cagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcat |
35916106 |
T |
|
| Q |
330 |
cccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaaca |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916107 |
cccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaaca |
35916206 |
T |
|
| Q |
430 |
atcannnnnnngccttaatcctttggttctcacgggaataagactg |
475 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916207 |
atcatttttttgccttaatcctttggttctcacgggaataagactg |
35916252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 497 - 581
Target Start/End: Original strand, 35916491 - 35916575
Alignment:
| Q |
497 |
atgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg |
581 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916491 |
atgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg |
35916575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6672 times since January 2019
Visitors: 5770