View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_15 (Length: 584)
Name: NF0796_low_15
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 90 - 402
Target Start/End: Original strand, 43760178 - 43760493
Alignment:
Q |
90 |
tttgtcgctcctgcgtgcgtgtatgttgttcttcatcttcttctaattgcacttgttgttttttcaatcccaataacctcaaatctcgaggcttgttttg |
189 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43760178 |
tttgtcgctcctgcgtgcgtgtgtgttgttcttcatcttcttctaattgcactttttgttttttcaatcccaataacctcaaatctcgaggcttgttttg |
43760277 |
T |
 |
Q |
190 |
ttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccaggg---tactgccagctacaccctcctcttt |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
43760278 |
ttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccagggtactactgccagctacaccctcctcttt |
43760377 |
T |
 |
Q |
287 |
tgctttggttcactgcactttgagttttggacttaagggtgtccttaatagctggagggtcggtgttcaacttgaattttttgtgcttttgcttcacatt |
386 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43760378 |
tgctttggttcactgcactttgagttttggacttaagggtgtccttaatagctggagggtcggtgttcaacttgaattttttgtgcttttgcttcacatt |
43760477 |
T |
 |
Q |
387 |
cacaagacgggtaccc |
402 |
Q |
|
|
|||||||||||||||| |
|
|
T |
43760478 |
cacaagacgggtaccc |
43760493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 518 - 571
Target Start/End: Original strand, 43760595 - 43760648
Alignment:
Q |
518 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttc |
571 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43760595 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttc |
43760648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University