View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_24 (Length: 449)
Name: NF0796_low_24
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 29 - 244
Target Start/End: Complemental strand, 18878427 - 18878217
Alignment:
Q |
29 |
agactttttgtgctgtttcttttttcagatccaccaaatccaacttccctcaaaaagcaagtaacacgcacaaacatgtaatgtaataacaagacaaact |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
18878427 |
agactttttgtgctgtttcttttttcagatccaccaaatccaacttcccccaaaaagcaagtaacacgcacaaacatgtaat-----aacaaaacaaact |
18878333 |
T |
 |
Q |
129 |
caaaggttcatcactttcataatcttcttacacaaacaaaacataacaaaaatagatagattatagtacaacattgtttctctctatttttggaccaacc |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18878332 |
caaaggttcatcactttcataatcttcttacacaaacaaaacaaaacaaaaatagatagattatagtacaacattgtttctctctatttttggaccaacc |
18878233 |
T |
 |
Q |
229 |
aacaatcacaaacttc |
244 |
Q |
|
|
|||||||||||||||| |
|
|
T |
18878232 |
aacaatcacaaacttc |
18878217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 274 - 439
Target Start/End: Complemental strand, 18878187 - 18878021
Alignment:
Q |
274 |
gtcaaaccaagtt-gtatgttcatcgttggaaatggaccaaccaccgtggaaggaagaagaagcggcggttggcggtggtgataggggaccaccacagcg |
372 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
18878187 |
gtcaaaccaagtttgtatgttcatcgttggaaatggaccaaccaccgtggaaggaagaagaagcggcggttggcggtggtgatgggggaccaccacagcg |
18878088 |
T |
 |
Q |
373 |
gcccaccttaactctgccgccacgtacggatgcacttttcagcggtggttttagccctggtcctatg |
439 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
18878087 |
gcccaccttaactctgccgccacgtacggatgtacttttcagcggtggttttagccctggtcctatg |
18878021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5660 times since January 2019
Visitors: 5758