View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_30 (Length: 418)
Name: NF0796_low_30
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 65 - 395
Target Start/End: Original strand, 42935061 - 42935391
Alignment:
| Q |
65 |
cggcttcaacaacgtttatttccgatttttcatttctctgttaaaataaaactataccctgccatctagtatttgagaagttcatattgaacgctagcta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42935061 |
cggcttcaacaacgtttatttccgatttttcatttctctgttaaaataaaactatcccctgccatctagtatttgagaagttcatattgaacgcttgcta |
42935160 |
T |
|
| Q |
165 |
cagatgcaacggtctctgtaggaccgttggatctaaatttattaaaattgatgtgacggtctctatagggccgtttcatctaaatttattaaaatttaga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935161 |
cagatgcaacggtctctgtaggaccgttggatctaaatttattaaaattgatgtgacggtctctatagggccgtttcatctaaatttattaaaatttaga |
42935260 |
T |
|
| Q |
265 |
tccaactatcttataatccgttgaactgcgcaacagttatagagaatccaaattccgtaacaggagcttaaattctctatgattgttgcgcatctccagt |
364 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
42935261 |
tccaactatcttataatccgttgcactgtgcaacagttatagagaatccaaattccgtaacaggagcttaaattctctatgattgttgcacatctccggt |
42935360 |
T |
|
| Q |
365 |
agagtatctaactttaagaaatacaacatat |
395 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
42935361 |
agagtatctaaatttaagaaatacaacatat |
42935391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 81 times since January 2019
Visitors: 5776