View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_41 (Length: 333)
Name: NF0796_low_41
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 75 - 141
Target Start/End: Complemental strand, 36573608 - 36573542
Alignment:
| Q |
75 |
cctatattttattcccacatggattataattaaattaaaacaataaacaatgatatattttaactac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573608 |
cctatattttattcccacatggattataattaaattaaaacaataaacaatgatatattttaactac |
36573542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 57
Target Start/End: Complemental strand, 36573675 - 36573647
Alignment:
| Q |
29 |
acatagtatgcccctttcaattttgcaat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36573675 |
acatagtatgcccctttcaattttgcaat |
36573647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University