View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_46 (Length: 298)
Name: NF0796_low_46
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2549294 - 2549074
Alignment:
| Q |
1 |
aacattgtcgccaattttttagggttagagtttgcaaattaggtttggaatgttaagaacggttagataataaggataaggatacacataggatgtattg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549294 |
aacattgtcaccaattttttagggttagagtttgcaaattaggtttggaatgttaagaatggttagataataaggataaggatacacataggatgtattg |
2549195 |
T |
|
| Q |
101 |
tgtcttggtccattgaatgaggagttttaaacaaatgcatcactatataactttagtttcttatgtatcttttagaatgacgtgttttgagccagtaata |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
2549194 |
tgtcttggtcccttgaatgaggagttttaaacaaatgcatcactatataactttagtttcttatgtatcttttagaatgacatgttttgag-cagtaata |
2549096 |
T |
|
| Q |
201 |
ctggtttgtatcttgtgttatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2549095 |
ctggtttgtatcttgtgttatg |
2549074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7206 times since January 2019
Visitors: 5775