View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_47 (Length: 297)
Name: NF0796_low_47
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 35 - 261
Target Start/End: Original strand, 6703643 - 6703873
Alignment:
Q |
35 |
tatctcagatatatggaacaagaaaagctaaacctatggtagcataagctaaatgaaaatgaaaagttagcatctaatcattgttnnnnnnn-cttagaa |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||| | |||||| ||||||| |||||| ||||||||||||||| | |||| |
|
|
T |
6703643 |
tatctcagatatatggaacaagaaaagctaaatctatggtagcatcatctaaataaaaatgataagttatcatctaatcattgttaaaaaaaacgtagat |
6703742 |
T |
 |
Q |
134 |
attttatcctaggtcagatctagctatagatatct---taagagcatgcatgattatttaaagatccaatgtatatgctaccccgtttcttgtaaggatt |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6703743 |
attttatcctaggtcagatctagctatagatatctaattaagagcatgcatgattatttaaagatccaatgtatatgctaccccgtttcttgtaaggatt |
6703842 |
T |
 |
Q |
231 |
caaacctttattaagtaataatgaggcaaca |
261 |
Q |
|
|
||||||||||||||||||| ||||||||||| |
|
|
T |
6703843 |
caaacctttattaagtaattatgaggcaaca |
6703873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University