View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0796_low_50 (Length: 277)

Name: NF0796_low_50
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0796_low_50
NF0796_low_50
[»] chr7 (2 HSPs)
chr7 (4-170)||(38215898-38216064)
chr7 (236-277)||(38216130-38216171)
[»] chr1 (1 HSPs)
chr1 (9-126)||(31749874-31749991)


Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 4 - 170
Target Start/End: Original strand, 38215898 - 38216064
Alignment:
4 aatgaaacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagc 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215898 aatgaaacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagc 38215997  T
104 cgaacgtgaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga 170  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215998 cgaacgcgaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga 38216064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 236 - 277
Target Start/End: Original strand, 38216130 - 38216171
Alignment:
236 cctgttgtgaggtagcaagaggttaatgaaccaaaaatattc 277  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38216130 cctgttgtgaggtagcaagaggttaatgaaccaaaaatattc 38216171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 31749991 - 31749874
Alignment:
9 aacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagccgaac 108  Q
    ||||||||||| | |||||| | ||||||||| ||||| |||| ||| |||||||| |||||||| |||||||| ||||||||||||||||| ||||| |    
31749991 aacaaaggtgtcaagaataacagtgtcaacatgactgcaattgacatcacaatgttggatgctgctgtcttgcatccagcattatagttcacggccgagc 31749892  T
109 gtgaaaacggtcctgaaa 126  Q
    | ||||| || |||||||    
31749891 gcgaaaatggccctgaaa 31749874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6326 times since January 2019
Visitors: 5767