View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_50 (Length: 277)
Name: NF0796_low_50
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 4 - 170
Target Start/End: Original strand, 38215898 - 38216064
Alignment:
| Q |
4 |
aatgaaacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215898 |
aatgaaacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagc |
38215997 |
T |
 |
| Q |
104 |
cgaacgtgaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga |
170 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215998 |
cgaacgcgaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga |
38216064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 236 - 277
Target Start/End: Original strand, 38216130 - 38216171
Alignment:
| Q |
236 |
cctgttgtgaggtagcaagaggttaatgaaccaaaaatattc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216130 |
cctgttgtgaggtagcaagaggttaatgaaccaaaaatattc |
38216171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 31749991 - 31749874
Alignment:
| Q |
9 |
aacaaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagccgaac |
108 |
Q |
| |
|
||||||||||| | |||||| | ||||||||| ||||| |||| ||| |||||||| |||||||| |||||||| ||||||||||||||||| ||||| | |
|
|
| T |
31749991 |
aacaaaggtgtcaagaataacagtgtcaacatgactgcaattgacatcacaatgttggatgctgctgtcttgcatccagcattatagttcacggccgagc |
31749892 |
T |
 |
| Q |
109 |
gtgaaaacggtcctgaaa |
126 |
Q |
| |
|
| ||||| || ||||||| |
|
|
| T |
31749891 |
gcgaaaatggccctgaaa |
31749874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University