View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_56 (Length: 268)
Name: NF0796_low_56
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 65 - 260
Target Start/End: Complemental strand, 33151582 - 33151385
Alignment:
Q |
65 |
cacaattaactagagataaccgtttttgaacggatgttaataccttccct--atgtaatcgaattatgaattcgaaatctagtttaaaggactatttttg |
162 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
33151582 |
cacaattaactagagataaccgtttttgaacggatgttaataccttccctctatgtaatcgaattatgaattcgaaatctagtttaaatgactatttttg |
33151483 |
T |
 |
Q |
163 |
ttttgaagggtttttataaggtacatcattccaagcacacattgtcagatcattaagagtgttaatatcagggtctctgtcatacttatattcatctc |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
T |
33151482 |
ttttgaagggtttttataaggtacatcattccaagcacacattgtcagatcattaagagtgttaatatcaaggtctatgtcatacttatatttatctc |
33151385 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University