View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0796_low_59 (Length: 257)

Name: NF0796_low_59
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0796_low_59
NF0796_low_59
[»] chr5 (1 HSPs)
chr5 (15-257)||(38543361-38543603)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 257
Target Start/End: Original strand, 38543361 - 38543603
Alignment:
15 tatgatgaagaagtgtagataaacttgctttagcatgtttataatttctcgtataggttaatcattagaaagttctgatagacaattagaatagattttt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38543361 tatgatgaagaagtgtagataaacttgctttagcatgtttataatttctcatataggttaatcattagaaagttctgatagacaattagaatagattttt 38543460  T
115 taggagctaacaagtagtgttagacaaatccttattggttaggaggcattgaatactttagtcagtaccttcatttagaggctcagtggaaatattattc 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38543461 taggagctaacaagtagtgttagacaaatccttattggttaggaggcattgagtactttagtcagtaccttcatttagaggctcagtggaaatattattc 38543560  T
215 tatttagaaatagttgaattttaattttagaaattataatttt 257  Q
    |||||||||||||||||||||||||||||||||||||||||||    
38543561 tatttagaaatagttgaattttaattttagaaattataatttt 38543603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5785 times since January 2019
Visitors: 5759