View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_59 (Length: 257)
Name: NF0796_low_59
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_59 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 257
Target Start/End: Original strand, 38543361 - 38543603
Alignment:
| Q |
15 |
tatgatgaagaagtgtagataaacttgctttagcatgtttataatttctcgtataggttaatcattagaaagttctgatagacaattagaatagattttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38543361 |
tatgatgaagaagtgtagataaacttgctttagcatgtttataatttctcatataggttaatcattagaaagttctgatagacaattagaatagattttt |
38543460 |
T |
|
| Q |
115 |
taggagctaacaagtagtgttagacaaatccttattggttaggaggcattgaatactttagtcagtaccttcatttagaggctcagtggaaatattattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38543461 |
taggagctaacaagtagtgttagacaaatccttattggttaggaggcattgagtactttagtcagtaccttcatttagaggctcagtggaaatattattc |
38543560 |
T |
|
| Q |
215 |
tatttagaaatagttgaattttaattttagaaattataatttt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38543561 |
tatttagaaatagttgaattttaattttagaaattataatttt |
38543603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5785 times since January 2019
Visitors: 5759