View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_67 (Length: 251)
Name: NF0796_low_67
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_67 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 26911898 - 26912134
Alignment:
Q |
13 |
aatatatcgtgttcttctctaacttaacttgcatgacaagtgtattaactaagcatatgtttgttctatcgtttgaattgtcaaatttacgtccaaaact |
112 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
26911898 |
aatatatcgtgttcttctc--acttaacttgcatgacaagtgtattaactaagcatatgtttgttctagcgtttgaattgtcaaatttacgtccaaaact |
26911995 |
T |
 |
Q |
113 |
atcttccaccacaactttatagaagttccgaaccttaacctttgcgtcaacgtgatttttcacagtgatttaggtgaacatgacccagttccaaacaagc |
212 |
Q |
|
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
26911996 |
agcttccaccacaactttttagaagttccgaaccttaacctttgcgtcaacgtgatttttcactgtgatttaggtgaacatgacccagttccaaacaagc |
26912095 |
T |
 |
Q |
213 |
actaactaaacattggtctactaagtcaattgatccgct |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26912096 |
actaactaaacattggtctactaagtcaattgatccgct |
26912134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University