View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_68 (Length: 249)
Name: NF0796_low_68
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_68 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 28 - 249
Target Start/End: Complemental strand, 26912703 - 26912482
Alignment:
| Q |
28 |
acgaaacgggtgaattaatacgtgaaaataattagtaagttcaaagttctacttagtcaaatagtgcaagttcaaagttcaaattcgggagttctctccg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912703 |
acgaaacgggtgaattaatacgtgaaaataattagtaagttcaaagttctacttagtcaaatagtgcaagttcaaagttcaaattcgggagttctctccg |
26912604 |
T |
 |
| Q |
128 |
gaaacaatatttttgtgtttttaaaagtttgagaagataatttccgaaggttgtttttcaggatatatggcaaataaaagaggagctaaacgagcaacta |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26912603 |
gaaaaaatatttttgtgtttttaaaagtttgagaagataatttccgaaggttgtttttcaggatatatggcaaataaaagaggagctaaacgagcaatta |
26912504 |
T |
 |
| Q |
228 |
ttgtcgaatttttgctaagttg |
249 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26912503 |
ttgtcgaatttttgctaagttg |
26912482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University