View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_69 (Length: 248)
Name: NF0796_low_69
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796_low_69 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 105 - 248
Target Start/End: Complemental strand, 33151877 - 33151732
Alignment:
Q |
105 |
gttcaaagattaattaattactgtcttgttttatattattatttcattat--tttcataataggcatttgagcctgatttaaaatcattgcaagaagaat |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33151877 |
gttcaaagattaattaattactgtcttgttttatattattagttcattatattttcataataggcatttgagcctgatttaaaatcattgcaagaagaat |
33151778 |
T |
 |
Q |
203 |
cttttctttaaaacaaatcaagaaacaaacgtttctacccaaaaaa |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33151777 |
cttttctttaaaacaaatcaagaaacaaacgtttctacccaaaaaa |
33151732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6813 times since January 2019
Visitors: 5772