View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796_low_70 (Length: 236)
Name: NF0796_low_70
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 72 - 218
Target Start/End: Original strand, 41127087 - 41127237
Alignment:
| Q |
72 |
catccaaattggaatctcacatgggcatgcccagtttcagtctgttatttgtttatttacgtacatgaccaaactcttac----tatatataatatgatt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41127087 |
catccaaattggaatctcacatgggcatgcccagtttcagtctgttatttgtttatttacgtacatgaccaaactcttactatatatatataatatgatt |
41127186 |
T |
|
| Q |
168 |
tgattcattctagtacacagcaacgtgtatgttgatttgttacctgacatc |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127187 |
tgattcattttagtacacagcaacgtgtatgttgatttgttacctgacatc |
41127237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7226 times since January 2019
Visitors: 5775