View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_high_6 (Length: 267)
Name: NF0798_high_6
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0798_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 54 - 238
Target Start/End: Complemental strand, 44543545 - 44543361
Alignment:
Q |
54 |
gacaaaacttcatggatatagttatgaattttgatcgtatcatgtgataatctaacattgaccttaaatcaacctgatttattggacaacttacaagttt |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
44543545 |
gacaaaacttcatggatatagttatgaattttgatcgtatcatgtgataatctaacattgaccttaaatcaacctcatttattggacaacttacaagttt |
44543446 |
T |
 |
Q |
154 |
ataatttattaattattaattattgtcaatcatgcaagactcatctctcgattataaccgtgaaacatgtaatcacggatggtgc |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44543445 |
ataatttattaattattaattattgtcaatcatgcaagactcatctctcgattataaccgtgaaacatgtaatcacggatggtgc |
44543361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University