View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_10 (Length: 328)
Name: NF0798_low_10
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0798_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 101 - 195
Target Start/End: Complemental strand, 40371100 - 40371006
Alignment:
| Q |
101 |
cataccataaataatcttgagaattttaatcatgtttttcttcttttgatgtgaaaaaacataacttatggagatgcaagaaattcttttgtaaa |
195 |
Q |
| |
|
|||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
40371100 |
cataccataaattaacttgagaattttaattatgtttttcttcttttgatgtgaaaaaacataacttatgaagatgcaagaaattattttgtaaa |
40371006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 40370988 - 40370936
Alignment:
| Q |
187 |
ttttgtaaactagtgtcattgttgaaagtcctttacatacattcatgtgttgt |
239 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
40370988 |
ttttgtaaactagtgttatttttgaaagtcttttacatacattcatgtgttgt |
40370936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5417 times since January 2019
Visitors: 5757