View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_12 (Length: 297)
Name: NF0798_low_12
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0798_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 12 - 268
Target Start/End: Complemental strand, 40826762 - 40826506
Alignment:
| Q |
12 |
atgaagacgacgatgtgagttgtttgtatatgtcaaaggatatcgttggtgctccatgacggatagtgtacctacgtgcaaggacttttacgttcaagtt |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40826762 |
atgaagacgacgatgggagttgtttgtatatgtcaaaggacatcgttggtgctccatgacaaatagtgtacctacgtgcaagaacttttacgttcaagtt |
40826663 |
T |
 |
| Q |
112 |
agtgaaaattttagaagagcgagaagtttaattaaaattgagaacaaatcttttatcaagtgttagtgaccttatatagatttataaaaaacttctgttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40826662 |
agtgaaaattttagaagagcgagaagtttaatcaaaattgagaacaaatcttttatcaagtgttagtgaccttatatagatttataaaaaacttctgttg |
40826563 |
T |
 |
| Q |
212 |
cgtaagttctaacataattcacatattatcgtctcattatcacgagggtcatgattt |
268 |
Q |
| |
|
|||| |||| ||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40826562 |
cgtaggttccaacataattcacatattattgtttcattatcacgagggtcatgattt |
40826506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University