View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_16 (Length: 262)
Name: NF0798_low_16
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0798_low_16 |
 | |
|
| [»] scaffold0168 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0168 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 134 - 234
Target Start/End: Original strand, 18551 - 18651
Alignment:
| Q |
134 |
ggagatgatagagcgttatttcaggtctcccccaacatttatgttctatattaagctaattgaattccaccatccatagctctgaatccaaacattgtct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18551 |
ggagatgatagagcgttatttcaggtctcccccaacatttatgttctattttaagctaattgaattccaccatccatagctctgaatccaaacattgtct |
18650 |
T |
|
| Q |
234 |
t |
234 |
Q |
| |
|
| |
|
|
| T |
18651 |
t |
18651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 18425 - 18490
Alignment:
| Q |
1 |
aatttcctatgtgataaaacgttgggaattatattttctttgcaattcaattgaaaaatggtgacg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18425 |
aatttcctatgtgataaaacgttgggaaatatattttctttgcaattcaattgaaaaatggtgacg |
18490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5862 times since January 2019
Visitors: 5760