View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_20 (Length: 253)
Name: NF0798_low_20
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0798_low_20 |
 | |
|
| [»] scaffold0168 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0168 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 18330 - 18087
Alignment:
| Q |
1 |
atacatgtttcaagtctaggcaatgnnnnnnnntactaacatattaacatttgtcattnnnnnnnntgtatattgcagttgaaagaatttcaattaccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18330 |
atacatgtttcaagtctaggcaatgaaaaaaaatactaacatattaacatttgtcattaaaaaaaatgtatattgcagttgaaagaatttcaattaccaa |
18231 |
T |
|
| Q |
101 |
acttgatagctaagcaaaatcaaggagataattctcaaagcctgacaaagataacacaagtaaggtgaattttatacatactggacggaatacccaaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18230 |
acttgatagctaagcaaaatcaaggagataattctcaaagcctgacaaagataacacaggtaaggtgaattttatacatactagacggaatacccaaggg |
18131 |
T |
|
| Q |
201 |
tttcaccggtttatttaaagactattacttttcccaccctatgc |
244 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||| ||||| |
|
|
| T |
18130 |
tttcaccggtttatctaaatactattacttttcacaccttatgc |
18087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6074 times since January 2019
Visitors: 5762