View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_23 (Length: 236)
Name: NF0798_low_23
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0798_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 4 - 96
Target Start/End: Complemental strand, 43939817 - 43939725
Alignment:
| Q |
4 |
aaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgctttagatttggctaattttggtgctaaacct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43939817 |
aaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgctttagatttggctaattttggtgctaaacct |
43939725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 43927911 - 43927847
Alignment:
| Q |
1 |
gggaaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
43927911 |
gggaaagagtttaaagatgaacatgttcttgttgttgggtctgggaattctggtatggaaattgc |
43927847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 15608216 - 15608285
Alignment:
| Q |
3 |
gaaagagtttaaagatgaa----catgttcttgttgttggttctggtaattctggtatggagattgcttt |
68 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| ||||| |||||||| ||||| | |||||| |
|
|
| T |
15608216 |
gaaagagtttaaagatgaattaacatgttctttttgttggatctgggaattctggcatggaaactgcttt |
15608285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5008 times since January 2019
Visitors: 5753