View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_24 (Length: 234)
Name: NF0798_low_24
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0798_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 43297725 - 43297500
Alignment:
Q |
1 |
taatggtatagacagtgttgaaatttatgtgtaagtggttagtttcaca-------ttgattaggaatgaactaaatcaattatatgtaagagtattaac |
93 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
43297725 |
taatggtatagacagtgttgaaatttatgtgtaagtggttagtttcacaattcacattgattacgaatgaactaaatcaattatatgtaagagtattaac |
43297626 |
T |
 |
Q |
94 |
ccagtttaatatgattcaatgagagtgaagtataactgaaatcaaaccaaccgacaaagtagtgtcgatttctagttcaacttgttgaaccaacccgatc |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43297625 |
ccagtttaatatgattcaatgagagtgaagtataactgaaatcaaaccaaccgacaaagtagtgtcgatttctagttcaacttgttgaaccaacccgatc |
43297526 |
T |
 |
Q |
194 |
agccagattttgcaaacgcttcttgg |
219 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
43297525 |
agccagattttgcaaacgcttcttgg |
43297500 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University