View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_26 (Length: 207)
Name: NF0798_low_26
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0798_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 52030478 - 52030355
Alignment:
Q |
10 |
gctacgttacgttattgtgcacaacaacaaaaatagtattaatggttcatttgtctctcaggcttccattttttccacactcattcttcgttttgcccct |
109 |
Q |
|
|
|||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52030478 |
gctacgttacgtgattgtgcacaacaa-aaaaatagtattaatggctcatttgtctctcaggcttccattttttccacactcattcttcgttttgcccct |
52030380 |
T |
 |
Q |
110 |
tccaatctgcaatttatatcgctac |
134 |
Q |
|
|
|| |||||||||||||||||||||| |
|
|
T |
52030379 |
tcaaatctgcaatttatatcgctac |
52030355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 207
Target Start/End: Complemental strand, 52030300 - 52030262
Alignment:
Q |
169 |
ttatttaattaaattctttatattgaattgaatacaatt |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52030300 |
ttatttaattaaattctttatattgaattgaatacaatt |
52030262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University