View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0798_low_8 (Length: 352)
Name: NF0798_low_8
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0798_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 253
Target Start/End: Complemental strand, 40013601 - 40013357
Alignment:
Q |
9 |
atgaataaagccaaattggttggtttctctgtatttttctctcaaacattacatgcaaccaattaattcctcttccataatgttatagcatctgcatggg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40013601 |
atgaataaagccaaattggttggtttctctgtatttttctctcaaacattacatgcaaccaattaattcctcttccataatgttatagcatctgcatggg |
40013502 |
T |
 |
Q |
109 |
actagaaccatatataatgccaaaaacactttacactcttatttataccaagctaaataggtattaccggtactttttgattccattgttctctcctttt |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40013501 |
actagaaccatatataatgccaaaaacactttacactcttatttataccaagctaaataggtattaccggtactttttgattccattgttctctcctttt |
40013402 |
T |
 |
Q |
209 |
gtcaaaaacaaagcatacataaaattccttgatggagggacaaca |
253 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40013401 |
gtcaaaaacaaagcatacataaaattccttgatggagggacaaca |
40013357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4593 times since January 2019
Visitors: 5751