View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0799_low_18 (Length: 270)
Name: NF0799_low_18
Description: NF0799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0799_low_18 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 43 - 240
Target Start/End: Original strand, 50238 - 50435
Alignment:
| Q |
43 |
tctcgcgtttgatttcagcatcaatcacactcctacacttgcttgctctgtgagcatagcgcaagcttcgcgagcttgaggttattgacaaacatgatgt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50238 |
tctcgcgtttgatttcagcatcaatcacactcctacacttgcttgttctgttagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgt |
50337 |
T |
 |
| Q |
143 |
cgcttcgccggaaaatgaagtcggtgaaaccttcaccgtcgtctcggatttcactttccggtcgccggagcaggaagaagatgtccacactacctttg |
240 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50338 |
cgcctcgccggaaaatgaagtcggtgaaaccttcgccgtcgtctcggatttcactttccggtcgccggagcaggaagaggatgtccacactacctttg |
50435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University