View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0799_low_24 (Length: 214)
Name: NF0799_low_24
Description: NF0799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0799_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 47717778 - 47717860
Alignment:
Q |
1 |
aaacaatcattgcaatcttgctgtgataaatcaggtgtacactgcacaagaccatatgtggtttcaaaattcaaagttgcatt |
83 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47717778 |
aaacaatcattgcaatcttgctgtgataaatcaggtgtacactgcacaagaccatatgtggtttcaaaattcaaagttgcatt |
47717860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 47712975 - 47713049
Alignment:
Q |
1 |
aaacaatcattgcaatcttgctgtgataaatcaggtgtacactgcacaagaccatatgtggtttcaaaattcaaa |
75 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
T |
47712975 |
aaacaatcattgcaatcttgctctgacaaatcaggtgtacactgcacaagaccatatatggtttgaaaattcaaa |
47713049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 47745567 - 47745649
Alignment:
Q |
1 |
aaacaatcattgcaatcttgctgtgataaatcaggtgtacactgcacaagaccatatgtggtttcaaaattcaaagttgcatt |
83 |
Q |
|
|
|||||||||||||||||||| ||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
47745567 |
aaacaatcattgcaatcttgtcctgacaagtcaggtgtacactgcacaagaccatatatggtttcaaaattcaaagttgcatt |
47745649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 47759890 - 47759964
Alignment:
Q |
1 |
aaacaatcattgcaatcttgctgtgataaatcaggtgtacactgcacaagaccatatgtggtttcaaaattcaaa |
75 |
Q |
|
|
||||||| |||||||||||||| ||| ||||||||||| ||||| |||||||||||| |||||| |||||||||| |
|
|
T |
47759890 |
aaacaattattgcaatcttgctctgacaaatcaggtgtgcactgaacaagaccatatatggtttgaaaattcaaa |
47759964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5881 times since January 2019
Visitors: 5761