View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0800_high_11 (Length: 218)
Name: NF0800_high_11
Description: NF0800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0800_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 48 - 135
Target Start/End: Original strand, 31651892 - 31651979
Alignment:
Q |
48 |
aatttactgatcaatagcgtccttcaattcagccgtggcttcctccgcttccttcaaggtcggaacctccccaaacaccattctcggc |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31651892 |
aatttactgatcaatagcgtccttcaattcagccgtggcttcctccgcttccttcaaggtcggaacctccccaaacaccattctcggc |
31651979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University