View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0800_high_7 (Length: 379)
Name: NF0800_high_7
Description: NF0800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0800_high_7 |
 |  |
|
| [»] scaffold0559 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 44 - 331
Target Start/End: Complemental strand, 31023456 - 31023169
Alignment:
| Q |
44 |
tgccatttgaccaacatctagggactagaatatgatgtaatatctttatttgtgaaattccctcatgaacaaaaggggtcttcaatgtagaatttaggtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31023456 |
tgccatttgaccaacatctagggactagaatatgatgtaatatctttatttgcgaaattccctcatgaacaaaaggggtcttcaatgtagaatttaggtt |
31023357 |
T |
 |
| Q |
144 |
taccggttattgtacttatggaacctgaatcgtagataaacttgaatatattataatcataggcttaatcttcttaggtgaagaaatccaacacataata |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31023356 |
taccggttattgtacttatggaacctgaatcgtagataaacttgaatctattataatcataggcttaatcttcttaggtgaagaaatccaacacataata |
31023257 |
T |
 |
| Q |
244 |
aaaaattaagaccctatttgtctgtttattcacgtcgaagagctcgttgtttggacaaatttcggctttgttgccatatgtacgacaa |
331 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31023256 |
aaaaattaagatcctatttgtctgtttattcacgtcgaagagcttgttgtttggacaaatttcggctttgttgccatatgtacgacaa |
31023169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0559 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0559
Description:
Target: scaffold0559; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 145
Target Start/End: Original strand, 1708 - 1811
Alignment:
| Q |
49 |
tttgaccaacatctagggactagaatatgatgtaatat-------ctttatttgtgaaattccctcatgaacaaaaggggtcttcaatgtagaatttagg |
141 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||| |||| |||||| ||||||||||| | |||||| ||||| ||||||||||||| |
|
|
| T |
1708 |
tttgaccaacatcgagggactaaaatatgatggaatatcttcctcctttgcatgtgaagttccctcatgagccaaagggttcttctttgtagaatttagg |
1807 |
T |
 |
| Q |
142 |
ttta |
145 |
Q |
| |
|
|||| |
|
|
| T |
1808 |
ttta |
1811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 145
Target Start/End: Complemental strand, 40775579 - 40775476
Alignment:
| Q |
49 |
tttgaccaacatctagggactagaatatgatgtaatat-------ctttatttgtgaaattccctcatgaacaaaaggggtcttcaatgtagaatttagg |
141 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||| |||| |||||| ||||||||||| | |||||| ||||| ||||||||||||| |
|
|
| T |
40775579 |
tttgaccaacatcgagggactaaaatatgatggaatatcttcctcctttgcatgtgaagttccctcatgagccaaagggttcttctttgtagaatttagg |
40775480 |
T |
 |
| Q |
142 |
ttta |
145 |
Q |
| |
|
|||| |
|
|
| T |
40775479 |
ttta |
40775476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University