View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0800_low_16 (Length: 254)
Name: NF0800_low_16
Description: NF0800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0800_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 87 - 245
Target Start/End: Original strand, 15541802 - 15541955
Alignment:
| Q |
87 |
caatttggaatgtatgacttggaatgtagcctcttaattacataattatctttttacccnnnnnnnnnnnnnnatttcacagaattgtagcatttcttat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15541802 |
caatttggaatgtatgacttggaatgtagcctcttaattacataattatctttttacccttttttttt-----atttcacagaactgtagcatttcttat |
15541896 |
T |
 |
| Q |
187 |
tcttcttactccgtttacattttttattctgctcaatttcttctttctgttgtctctgc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15541897 |
tcttcttactccgtttacattttttattctgctcaatttcttctttctgttgtctctgc |
15541955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 145
Target Start/End: Complemental strand, 18052705 - 18052566
Alignment:
| Q |
4 |
aaatatgggtggaatggaatgggatgtaatggatggaatagattccatcccattccatcattctctcttannnnnnnccc-tcccaatttggaatgtatg |
102 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||||| |||||||||| |||||||||| ||||||| || ||||||||||| |||||| |
|
|
| T |
18052705 |
aaatatggatggaatggagtgggatgt----gatggaatacattccatcccgttccatcattttctcttatttttcttccatcccaatttggggtgtatg |
18052610 |
T |
 |
| Q |
103 |
acttggaatgtagcctcttaattaca-taattatctttttaccc |
145 |
Q |
| |
|
| ||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
18052609 |
agatggaatgaagcatcttaattacattaattatctttttaccc |
18052566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University