View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_high_4 (Length: 287)
Name: NF0801_high_4
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0801_high_4 |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
| [»] scaffold0481 (2 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold1160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 77)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 39077086 - 39076808
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataaagaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39077086 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcagtacctactgagataagctcacgaagacgtataaagaagtt |
39076987 |
T |
 |
| Q |
101 |
gtttgttatagtataaaaaatcnnnnnnncctnnnnnnnntataaataaattcggactgggactatggggggtataaatcaattcatatatctttataaa |
200 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076986 |
ctttgttatagtataaaaaatctttttttcc--aaaaaaatataaataaattcggactgggactatggggggtataaatcaattcatatatctttataaa |
39076889 |
T |
 |
| Q |
201 |
aatcattatctccccttttatttaccgaaaaacaattcatctctcgaggattagtatgagtagtattaaatttggtctctg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076888 |
aatcattatctccccttttatttaccgaaaaacaattcatctctcgaggattagtatgagtagtattaaatttggtctctg |
39076808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 39076600 - 39076329
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataaagaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39076600 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcagtacctactgagataagctcacgaagacgtataaagaagtt |
39076501 |
T |
 |
| Q |
101 |
gtttgttatagtataaaaaatcnnnnnnncctnnnnnnnntataaataaattcggactgggactatggggggtataaatcaattcatatatctttataaa |
200 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076500 |
ctttgttatagtataaaaaatctttttttcc--aaaaaaatataaataaattcggactgggactatggggggtataaatcaattcatatatctttataaa |
39076403 |
T |
 |
| Q |
201 |
aatcattatctccccttttatttaccgaaaaacaattcatctctcgaggattagtatgagtagtattaaatttg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076402 |
aatcattatctccccttttatttaccgaaaaacaattcatctctcgaggattagtatgagtagtattaaatttg |
39076329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 14279553 - 14279609
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14279553 |
tttttttggtggtggtcagagttcgaaccccgaaccttgcatattttatgcattgtc |
14279609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 8461817 - 8461900
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaa |
84 |
Q |
| |
|
||||| ||||| ||| || ||||| |||| |||||||||||||||||||||||||||||| | | || ||| |||||||||||| |
|
|
| T |
8461817 |
atttttttggtagtggtcggggtttgaactccggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaa |
8461900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 26733948 - 26734018
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtata |
92 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| | |||||| ||||||||||| ||| |||| |
|
|
| T |
26733948 |
gttcgaaccctggaccttgcatattttatgcactgtccctgccaaccgaggtaagctcacgaggacttata |
26734018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 29499850 - 29499769
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | |||||||||||| ||||||||||||||||||||||||||| || | | ||| ||||||||||| |
|
|
| T |
29499850 |
tttttttggtggtgtttggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacga |
29499769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 1921782 - 1921714
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||| || || ||| ||||||||||| |
|
|
| T |
1921782 |
gggttcgaaccccggaccttgcatatatttatgcattgtcgctatcaacttagctaaactcacgaagac |
1921714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 9655997 - 9656057
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| || | || ||| |||||||| |
|
|
| T |
9655997 |
gggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagctaagctca |
9656057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 82
Target Start/End: Complemental strand, 19778144 - 19778064
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
19778144 |
tttttttggtggtgtctaggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacg |
19778064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 24838157 - 24838209
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24838157 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
24838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 1764954 - 1765017
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| | |||| || ||| ||||||||||| |
|
|
| T |
1764954 |
gggttcgaaccccggatcttgcatattttatgcgttgttcatatcaactgagttaagctcacga |
1765017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 1922380 - 1922333
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatat-tttatgcattgtccctatc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
1922380 |
cagggttcgaaccccggaccttgcatatatttatgcattgtcactatc |
1922333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 2554210 - 2554273
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| ||||||| |||| || ||| ||||||||| |
|
|
| T |
2554210 |
caggattcgaaccccagaccttgcatattttatgtattgtccatatcaactgagctaagctcac |
2554273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 6314335 - 6314386
Alignment:
| Q |
32 |
cggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
6314335 |
cggaccttgcatattttatgcattgtccttatcaactgagctaagctcacga |
6314386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 25277216 - 25277251
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25277216 |
gggttcgaaccccggaccttgcatattttatgcatt |
25277251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 30623372 - 30623293
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||| ||||| ||| || ||||||||||||| |||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
30623372 |
tttttttggtcgtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagctcac |
30623293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 39821945 - 39821882
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||| |||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
39821882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 19163526 - 19163604
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |||| |
|
|
| T |
19163526 |
gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaagctcacgaggacg |
19163604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 22504271 - 22504329
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||| |||||| | ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
22504271 |
atttttttggtagtgatcggagtttgaaccccgaaccttgcatattttatgcattgtcc |
22504329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 24023402 - 24023452
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| ||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24023402 |
ttggtagtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 26914052 - 26914106
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
26914052 |
atttttttggtggtgaccagggttcgaaccccagaccttacatattttatacatt |
26914106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 27750905 - 27750967
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| || | || ||| ||||||||||| |
|
|
| T |
27750905 |
ggttcgaaccccggaccttgcatatattatgcactgtccttaccaactgagctaagctcacga |
27750967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 8837971 - 8837918
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||||| |||| |||||| |
|
|
| T |
8837971 |
cccggaccttgtatatattatgcattgtccctatcaaccgagttaagttcacga |
8837918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 12748980 - 12748923
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
12748980 |
tttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
12748923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 13105154 - 13105113
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
13105154 |
ggttcgaaccccggcccttgcatatattatgcattgtcccta |
13105113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 13124363 - 13124400
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13124363 |
gggtttgaaccccggaccttgcatattttatgcattgt |
13124400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 16843521 - 16843590
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||||||| || ||||||||||| |||| |||||||| |||| | |||| |||||||||| |||| |
|
|
| T |
16843521 |
cagggttcgaaccacgaaccttgcatatattatacattgtccttatcaatcgagttaagctcacggagac |
16843590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 22775707 - 22775650
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
22775707 |
tttttttggtggtggccagggtttgaaccccggaccttgcataaattatgcattgtcc |
22775650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 22948088 - 22948125
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcattgtccctatc |
22948125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 26886040 - 26886081
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26886040 |
cagggttcgaaccccggatcttacatattttatgcattgtcc |
26886081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 27718900 - 27718957
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
27718900 |
gaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacga |
27718957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 38763513 - 38763554
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
38763513 |
cagggttcgaaccccagaccttgcatatattatgcattgtcc |
38763554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 39433469 - 39433408
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| | |||| || ||| ||||||||||| |
|
|
| T |
39433469 |
gttcgaaccccagaccttgcatattttatgtattgttcatatcaactgagctaagctcacga |
39433408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 2908095 - 2908139
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
2908095 |
cagggttcgaaccccggcccctgcatatattatgcattgtcccta |
2908139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 11709056 - 11708984
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || ||||| |||| |||||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
11708984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 12800887 - 12800939
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
12800887 |
ttggtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtcc |
12800939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 26799238 - 26799182
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | || ||| |||||| |||| |
|
|
| T |
26799238 |
aaccccgaaccttgcatattttatgcattgtccctaccaactgagttaagcttacga |
26799182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 27587295 - 27587219
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| | ||||||||||| || | || ||| ||||||||||| |
|
|
| T |
27587295 |
ttggtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaagctcacga |
27587219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 79
Target Start/End: Complemental strand, 29546963 - 29546895
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctc |
79 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||| |||| |||||||||||| || ||| ||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattatctattgtccctatcaactgagttaagctc |
29546895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 31832072 - 31832132
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||| ||||||||| | ||||||||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
31832072 |
tttttttggtggtgtccggggttcgaaacccggacattgcatatattatgcattgtcccta |
31832132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 32051519 - 32051571
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
32051519 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
32051571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 34645085 - 34645125
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatatt-ttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34645085 |
gggttcgaaccccggaccttgcatattattatgcattgtcc |
34645125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 943171 - 943120
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
943171 |
ttggtggtggttggggttcgaattccggaccttgcatattttatgcattgtc |
943120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 11053037 - 11052998
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
11053037 |
gggttcaaaccccggaccttgcatatattatgcattgtcc |
11052998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 20665363 - 20665402
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
20665363 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
20665402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 24429859 - 24429816
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
24429859 |
ggttcgaaccccgaaccttacatattttatgcattgtccatatc |
24429816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 29244778 - 29244813
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29244778 |
gggttcgaatcccggaccttgcatattttatgcatt |
29244813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 30550726 - 30550765
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
30550726 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
30550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 32192955 - 32192916
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32192955 |
gggttcgaaccccgaaccttgcatatattatgcattgtcc |
32192916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 37873038 - 37872975
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| || || | || ||| ||||||||||| |
|
|
| T |
37873038 |
gggttcgaaccacgtaccttgcatattttatgcattgaccataccaactgagctaagctcacga |
37872975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 44215475 - 44215514
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
44215475 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
44215514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 8881336 - 8881294
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
8881336 |
gggtttgaaccctggaccttgcatatattatgcattgtcccta |
8881294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 13575349 - 13575287
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| | || ||| ||| ||||||| |
|
|
| T |
13575349 |
ggttcgaacctcggaacttgcatatgttatgcattgtccctaccaactgagctaaactcacga |
13575287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 23852990 - 23852909
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | || ||| |||| |||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
23852990 |
tttttttggtggtgggcgggattcaaaccacggaccttgcatatattatgcattgtccataccgactgagctaagctcacga |
23852909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 27050814 - 27050769
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
27050814 |
gtggtggtcagggttcgaacctcataccttgcatattttatgcatt |
27050769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 32555325 - 32555276
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| | ||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32555325 |
gtggtgaccggggttcgaaccttgaaccttgcatattttatgcattgtcc |
32555276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 32944830 - 32944879
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
32944830 |
gtggtggtcggggtttgaacctcagaccttgcatattttatgcattgtcc |
32944879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 33105452 - 33105415
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
33105452 |
gggtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 33743630 - 33743597
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
33743630 |
gaacctcggaccttgcatattttatgcattgtcc |
33743597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 42200652 - 42200725
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| || |||| ||||| | |||| ||||||| |||| ||||||||||||| || ||| ||||||||||| |
|
|
| T |
42200652 |
gtggtgaccaaggtttgaacctcagaccatgcatatattatacattgtccctatcaactgagctaagctcacga |
42200725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 44293646 - 44293573
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||||||||||||||| || ||| ||||| |||||||||||| || | || ||| ||||||||||| |
|
|
| T |
44293646 |
gtggtggtcagggttcgaaccccagatcttacatatattatgcattgtctataccaactgagctaagctcacga |
44293573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 44602656 - 44602619
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
44602656 |
gttcgaactccggaccttgcatatattatgcattgtcc |
44602619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 444467 - 444435
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
444467 |
aaccccggaccttgcatatattatgcattgtcc |
444435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 92
Target Start/End: Original strand, 1244705 - 1244777
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtata |
92 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||| || | || ||| |||| ||||| || |||||| |
|
|
| T |
1244705 |
gggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgagctaagttcacggagccgtata |
1244777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 1877665 - 1877725
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
1877665 |
ttcgaacccgtgaccttgcatatattatgcattgtctatatcaactgagttaagctcacga |
1877725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 4830066 - 4830030
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
4830066 |
ttcgaaccccgaaccttgcatatattatgcattgtcc |
4830030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 8072788 - 8072752
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
8072788 |
ggttcgaaccccggaccttgtatatattatgcattgt |
8072752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 12770432 - 12770372
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||||||||||||| || |||||| ||||||| |||||||||| || ||| |||||||| |
|
|
| T |
12770432 |
gggttcgaaccccggcccctgcataaattatgcaatgtccctatcaactgagctaagctca |
12770372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 15438507 - 15438475
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcattgtcc |
15438475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 15529811 - 15529779
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcattgtcc |
15529779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 24696003 - 24696067
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||| ||| | |||| ||||||||| ||||||||||||| |||| || ||||||| ||||| |
|
|
| T |
24696003 |
tcagggtttgaatctcggatcttgcatatattatgcattgtccatatcaactgagataatctcac |
24696067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 54
Target Start/End: Original strand, 30176401 - 30176453
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30176401 |
tttttttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 34997520 - 34997456
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
34997520 |
gggttcgaacccatgaccttgcatatatttatgcattgtctatatcaactgagctaagctcacga |
34997456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 37872263 - 37872207
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| || | ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37872263 |
tttttttggtggtggtcggagttcgaaccccaaaccttgcatattttatgtattgtc |
37872207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 42367792 - 42367728
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||| |||||| || ||||| ||||||||||| | |||| || ||| |||||||||| |
|
|
| T |
42367792 |
cagggttcgaactccggacttttcatatattatgcattgttcttatcaactgagctaagctcacg |
42367728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Complemental strand, 42700551 - 42700503
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| |||||||||||| ||| | |||||| ||||||||||| |
|
|
| T |
42700551 |
accttgcatatattatgcattgtctctaccaaccgagttaagctcacga |
42700503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 43778098 - 43778042
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| || | ||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
43778098 |
tttttttggtggtggtcggagtttgaacctcagaccttgcatattttatgcattgtc |
43778042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 101)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 20799376 - 20799457
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||| ||||||| |||||||||||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
20799376 |
tttttttggtggtgaccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
20799457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 9946501 - 9946425
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
9946501 |
ttggtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
9946425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 14542747 - 14542799
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
14542747 |
ttggtggtgttcagggttcgaaccccagaccttgcatatattatgcattgtcc |
14542799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 32139401 - 32139337
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||| || ||| ||||||||||| |
|
|
| T |
32139401 |
gggttcgaaccccggaccttgcatatatttatgtattgtccctatcaactgagctaagctcacga |
32139337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 7371548 - 7371615
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| |||| || ||| |||||||||| |||| |
|
|
| T |
7371548 |
gggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgagttaagctcacggagac |
7371615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 21991247 - 21991310
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || | || |||||||||||||| |
|
|
| T |
21991247 |
gggttcgaactccggaccttgcatattttatgcattgtccataccaactaagataagctcacga |
21991310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 35021467 - 35021530
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||| |||| || ||| ||||||||||| |
|
|
| T |
35021467 |
gggttcgaaccccgaaccttgcatattttatgtattgtccatatcaactgagctaagctcacga |
35021530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 10303512 - 10303574
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
10303512 |
ggttcgaaccccggatcttgcatattttatgcattgtccttaccaactgagctaagctcacga |
10303574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 10497330 - 10497253
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||| || | |||||||||||||| |||||||||||||||||||||| || | | ||| ||||||||||||||| |
|
|
| T |
10497330 |
gtggtgaccatgattcgaaccccggactttgcatattttatgcattgtccataccaattgagctaagctcacgaagac |
10497253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 16470375 - 16470326
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16470375 |
gtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtcc |
16470326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 23303998 - 23304079
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||||| |||||||||||||||||| |||||| ||||||||| | || ||| ||||||||||| |
|
|
| T |
23303998 |
tttttttggtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaagctcacga |
23304079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 24664981 - 24665054
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
24664981 |
gtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaagctcacga |
24665054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 29908127 - 29908050
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||| ||||||||||||| || | || ||| ||||||||||||||| |
|
|
| T |
29908127 |
gtggtgatcgaggtttgaactccggaccttgcatatattatgcattgtccttaccaactgagttaagctcacgaagac |
29908050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 47806238 - 47806295
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| || ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
47806238 |
tttttttggtggtgttcggggttcgaaccccagaccttgcatatattatgcattgtcc |
47806295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 50362140 - 50362213
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataaa |
94 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||||||||| | || ||| ||||||||||| ||| |||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacatataaa |
50362213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 54857597 - 54857678
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||||||||||||||| || | |||||| ||||||||||| |
|
|
| T |
54857597 |
tttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtttataccaaccgagctaagctcacga |
54857678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 56564973 - 56565046
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||||||||||| |||| | ||| ||||||||||| |
|
|
| T |
56564973 |
gtggtgttcggggttcgaaccctagaccttgcatattttatgcattgtccatatcaattgagctaagctcacga |
56565046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 12698655 - 12698591
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| ||| || ||| ||||||||||||||| |
|
|
| T |
12698655 |
ttcgaaccccagaccttgcatatattatgcattgtccaaatcaactgagctaagctcacgaagac |
12698591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 34833988 - 34834044
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| ||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34833988 |
tttttttggtggtgtccagtgttcgaaccccggaccttgcatatattatgcattgtc |
34834044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 35287507 - 35287575
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| | || | || ||| ||||||||||| |||| |
|
|
| T |
35287507 |
gggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaagctcacgaggacg |
35287575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 39171369 - 39171433
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||||| | ||||||||||||||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
39171369 |
agggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaagctcacga |
39171433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 43374272 - 43374340
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||| |||| ||| ||||||||||||||||||||||||| |||| || ||| ||||||||||| |||| |
|
|
| T |
43374272 |
gggtttgaactccgaaccttgcatattttatgcattgtccatatcaactgagctaagctcacgaggacg |
43374340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 2649732 - 2649775
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
2649732 |
agggttcgaactccggaccttgcatatattatgcattgtcccta |
2649775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 19908763 - 19908692
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
19908763 |
gtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttaccaactgagttaagctcac |
19908692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 48955352 - 48955285
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||| || | || ||||||||||||||| |||| |
|
|
| T |
48955352 |
ggttcgaaccccggactttgcatatattacgcattgtccttaccaactgagataagctcacgaggacg |
48955285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 49473706 - 49473643
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| || | || | | ||||||||||| |
|
|
| T |
49473706 |
gggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaagctcacga |
49473643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 6459925 - 6459987
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
6459925 |
ggttcgaactccggaccttacatatattatgcattgtccatatcaactgagttaagctcacga |
6459987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 7230340 - 7230278
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
7230340 |
ggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacga |
7230278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 80
Target Start/End: Original strand, 11949753 - 11949823
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||| ||||||||||||| || | || ||| |||||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctca |
11949823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 23775579 - 23775537
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
23775579 |
gggttcgaaccctggaccttgcatatattatgcattgtcccta |
23775537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 32180901 - 32180823
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||| || ||||||||||||| ||| ||||||||||||||||||||| || | || ||| ||||||||||| |||| |
|
|
| T |
32180901 |
gtggtggtcggggttcgaaccccagactttgcatattttatgcattgtctataccaactgagctaagctcacgaggacg |
32180823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 37255010 - 37254968
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgtccct |
61 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
37255010 |
agggttcgaaccccggaccttacatatattatgcattgtccct |
37254968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 3936688 - 3936651
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3936688 |
gggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 12671749 - 12671786
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12671749 |
ggttcgaaccccggatcttgcatattttatgcattgtc |
12671786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 20383549 - 20383488
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
20383549 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcac |
20383488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 24079830 - 24079879
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
24079830 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattgtcc |
24079879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 44732580 - 44732527
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
44732580 |
atttttttggtggtggtcagggtttgaaccccgtatcttgcatattttatgcat |
44732527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 54500640 - 54500567
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||| ||| |||||||||||||| ||||| |||||||||||| ||| | || ||| ||||||||||| |
|
|
| T |
54500640 |
gtggtggtcagtgtttgaaccccggaccttacatatattatgcattgtctctaccaactgagctaagctcacga |
54500567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 9028054 - 9028114
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||| ||||||||| | || |||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
9028054 |
tttttttggtggtggttgggattcgaaccccagaccttacatattttatgcattgtcccta |
9028114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 19588215 - 19588147
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| || | | ||| ||||||||||| |||| |
|
|
| T |
19588215 |
gggtttgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacgaggacg |
19588147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 81
Target Start/End: Complemental strand, 19854625 - 19854565
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
19854625 |
ggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagctaagctcac |
19854565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 93
Target Start/End: Original strand, 21317339 - 21317411
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataa |
93 |
Q |
| |
|
|||| ||||||| |||||||||||| |||||||||||| ||| | || ||| |||||||||||| ||| |||| |
|
|
| T |
21317339 |
ggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagctaagctcacgaaaacggataa |
21317411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 25783455 - 25783491
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25783455 |
gaaccccggaccttgcatatattatgcattgtcccta |
25783491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 34033403 - 34033331
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || |||||| ||| |||||||||||||||||||||||| || | |||| || ||| ||||||||||| |
|
|
| T |
34033403 |
tggtggtcggggttcaaactccggaccttgcatattttatgcatggttcttatcaactgagttaagctcacga |
34033331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 35576621 - 35576569
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
35576621 |
ttggtggtggtcagggtttaaacctcggaccttgcatattttatacattgtcc |
35576569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 37800910 - 37800854
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||| |||||||| ||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
37800910 |
tttttttgttggtgatcggggttcgaaccccagacctcgcatatattatgcattgtc |
37800854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 44221511 - 44221435
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataa |
93 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||| || | || || ||||||||||| ||| ||||| |
|
|
| T |
44221511 |
tcagggttcgaacctcagaccttgcatatattatgcattgtccataccaactgaattaagctcacgatgacatataa |
44221435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 46676502 - 46676558
Alignment:
| Q |
24 |
tcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| || | || ||| |||||||| |
|
|
| T |
46676502 |
tcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctca |
46676558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 675979 - 675940
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
675979 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
675940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 1757024 - 1756973
Alignment:
| Q |
32 |
cggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| || || ||| ||||||||||| |
|
|
| T |
1757024 |
cggaccttgcatattttatgcattgtcccaatgaactgagttaagctcacga |
1756973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 87
Target Start/End: Original strand, 6789430 - 6789493
Alignment:
| Q |
24 |
tcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || | || ||| |||||||| |||||| |
|
|
| T |
6789430 |
tcgaaccccggaccttgcatatactatgcattgtccttaccaactgagctaagctcaagaagac |
6789493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 7248397 - 7248334
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| ||| || ||| ||| ||||||| |
|
|
| T |
7248397 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaactcacga |
7248334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 10261769 - 10261808
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
10261769 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
10261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 16431677 - 16431638
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
16431677 |
gggtttgaaccccagaccttgcatattttatgcattgtcc |
16431638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 21562686 - 21562647
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
21562686 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
21562647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 26926710 - 26926749
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
26926710 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
26926749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 31138993 - 31139032
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
31138993 |
gggtttgaacctcggaccttgcatattttatgcattgtcc |
31139032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 36203285 - 36203234
Alignment:
| Q |
32 |
cggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
36203285 |
cggaccttgcatatattatgcattgtccttatcaactgagctaagctcacga |
36203234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 38453326 - 38453263
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
38453326 |
gggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaagctcacga |
38453263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 43330207 - 43330168
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
43330207 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
43330168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 43722836 - 43722753
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtataa |
93 |
Q |
| |
|
|||||| | |||||| |||||||||||||| ||||| ||||||||||||| || | || ||| ||| ||||||| ||| ||||| |
|
|
| T |
43722836 |
gtggtgtttagggtttgaaccccggaccttacatatattatgcattgtccataccaactgagttaaactcacgaggacatataa |
43722753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 46745249 - 46745182
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgt |
89 |
Q |
| |
|
|||||| || || ||||||||||| |||| |||||||| |||| || ||||||||||||||| ||||| |
|
|
| T |
46745249 |
gttcgatcctcgtaccttgcatatattatacattgtccatatcaactgagataagctcacgaggacgt |
46745182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Complemental strand, 48226747 - 48226716
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48226747 |
gaaccccggaccttgcatattttatgcattgt |
48226716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 49308881 - 49308842
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgtcc |
49308842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 241393 - 241447
Alignment:
| Q |
29 |
ccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| | || | |||||| |||||| |||| |
|
|
| T |
241393 |
ccccggaccttgcatattttatgcattgttcataccaaccgagctaagcttacga |
241447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 12322733 - 12322671
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaagctcacga |
12322671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Original strand, 19479468 - 19479514
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19479514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 36662369 - 36662407
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
36662369 |
gggttcgaacccctgaccttgtatattttatgcattgtc |
36662407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 49041981 - 49042019
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
49041981 |
gggtttgaaccccggaccttgcatatattatgcattgtc |
49042019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 64
Target Start/End: Original strand, 49953409 - 49953447
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
49953409 |
gaaccccggaccttgcatatattatgcattgtccatatc |
49953447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 5924728 - 5924647
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| || |||| |||||||||||||| ||||| ||||| ||||||| || | || ||| ||||||||||| |
|
|
| T |
5924728 |
tttttttggtggtggtcgaggtttgaaccccggaccttccatatattatgtattgtccatagcaactgagctaagctcacga |
5924647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 11198823 - 11198762
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
11198823 |
gttcgaaccccagaccttacatattttatgcattctccataccaactgagctaagctcacga |
11198762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 21114295 - 21114344
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
21114295 |
gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtcc |
21114344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 79
Target Start/End: Original strand, 21318243 - 21318312
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctc |
79 |
Q |
| |
|
|||||| || ||||| |||||| |||||||||||| |||||||||||||||| | || ||| ||||||| |
|
|
| T |
21318243 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagttaagctc |
21318312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 87
Target Start/End: Complemental strand, 23619156 - 23619095
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||| || ||| ||||||||||||||||||||| | || ||| |||| |||||||||| |
|
|
| T |
23619156 |
gaaccccgaactttgtatattttatgcattgtccctaccaactgaggtaagttcacgaagac |
23619095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 30847988 - 30848021
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
30847988 |
gaacctcggaccttgcatattttatgcattgtcc |
30848021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 32711796 - 32711861
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||||||| || | || |||||| |||||||| |
|
|
| T |
32711796 |
cagggtttaaacctcggaccatgcatattttatgcattgtccataccaactgagatatgctcacga |
32711861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 43034324 - 43034405
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| ||||| | |||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
43034324 |
tttttttggtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactgagttaagctcacga |
43034405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 48226504 - 48226537
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
48226504 |
gaaccccagaccttgcatattttatgcattgtcc |
48226537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 56497590 - 56497647
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | || |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
56497590 |
tttttttggtggtggccgggattcgaaccccagaccttgcatatattatgcattgtcc |
56497647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 7030904 - 7030956
Alignment:
| Q |
31 |
ccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
7030904 |
ccggaccttgcatattttatgcattgtctataccaactgagttaagctcacga |
7030956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 7922249 - 7922312
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||||||||| || | || |||||||||||||| |
|
|
| T |
7922249 |
cagggttcgaaccc-ggatcttgcatatattatgcattgtctttaccaactgagataagctcacg |
7922312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 11144647 - 11144703
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| | |||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
11144647 |
tttttttggtggtgtccggggttcaaaccccagaccttgcatatattatgcattgtc |
11144703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 14202466 - 14202542
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||| || ||||| |||||||||||||| ||||| ||||||||| ||| ||| || ||| ||||||||||| |
|
|
| T |
14202466 |
ttggtagtggtcggggtttgaaccccggaccttacatatattatgcattatccaaatcaactgagttaagctcacga |
14202542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 15988491 - 15988439
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
15988491 |
ttggtggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgtcc |
15988439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 17423183 - 17423215
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
17423183 |
gaaccccggaccttgcatatattatgcattgtc |
17423215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 17629696 - 17629756
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||| || || || ||||||||||| |
|
|
| T |
17629696 |
ttcgaaccccgaaccttgcgtatattatgcattgtccctgtcaacttagctaagctcacga |
17629756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 22040711 - 22040667
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||| |||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtccatatc |
22040667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 83
Target Start/End: Original strand, 22630351 - 22630423
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || ||||| ||||| | |||||||||||| |||||||||||| ||| | || ||||||| ||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactgagataatctcacga |
22630423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 23160111 - 23160059
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||| |||| ||| ||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
23160111 |
gtggtgttcagagtttgaacctcggaccttacatatattatgcattgtcccta |
23160059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 23247605 - 23247661
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||| || | |||||| ||||||||||| |
|
|
| T |
23247605 |
aaccccagaccttgcatatattatgcgttgtccataccaaccgagctaagctcacga |
23247661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 25404738 - 25404690
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttat |
50 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |||||| ||||| |||| |
|
|
| T |
25404738 |
tttttttggtggtggtcagggttcgaacccccgaccttacatatattat |
25404690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 25978375 - 25978339
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
25978375 |
ttcgaacctcggaccttgcatatattatgcattgtcc |
25978339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Complemental strand, 27740799 - 27740763
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27740799 |
gttcgaactccgaaccttgcatattttatgcattgtc |
27740763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 29681444 - 29681496
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| || |||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
29681444 |
ttggtggtggtcgaggttcgaacctcagacattgcatattttatgcattgtcc |
29681496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 31352170 - 31352134
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
31352170 |
ttcgaacctcgtaccttgcatattttatgcattgtcc |
31352134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 33 - 81
Target Start/End: Complemental strand, 31780793 - 31780745
Alignment:
| Q |
33 |
ggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||||||||||||||||||||| || | || ||| ||||||||| |
|
|
| T |
31780793 |
ggaccttgcatattttatgcattgtccttaccaactgagctaagctcac |
31780745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 32737734 - 32737774
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
32737734 |
agggttcgaaccccagaccttgcatatattatacattgtcc |
32737774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 33933743 - 33933807
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||| ||||||||||| || ||||||| ||||||| |||||||| | || ||| |||||||||| |
|
|
| T |
33933743 |
caggggtcgaaccccggcccctgcatatattatgcaatgtccctaccaactgagctaagctcacg |
33933807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 34546008 - 34545956
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| |||||||||| | | ||||||||||||| ||||||||||||| |
|
|
| T |
34546008 |
ttggtggtgtccagggttcgatctctggaccttgcatatattatgcattgtcc |
34545956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 42845079 - 42845023
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
42845079 |
aaccccggaccttgcatatattatgcattgtcctttccaactgagttaagctcacga |
42845023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 98)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 24593455 - 24593370
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||| || | || ||| |||||||||| |||| |
|
|
| T |
24593455 |
tttttttggtggtgttcagggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacggagac |
24593370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 31815877 - 31815950
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagttaagctcacga |
31815950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 36474817 - 36474764
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctc |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||| ||||||| |
|
|
| T |
36474817 |
gaaccccggaccttgcatattttatgcattgtccctatcaactgagctaagctc |
36474764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 24305308 - 24305372
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||| || ||| ||||||||||||||| |
|
|
| T |
24305308 |
ttcgaaccccgaaccttgcatattttatgcattgtccatattaactgagctaagctcacgaagac |
24305372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 8091164 - 8091219
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || |||| ||||||||||||| |
|
|
| T |
8091164 |
gaaccccggaccttgcatatattatgcattgtccatacctactgagataagctcac |
8091219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 20565075 - 20565138
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
20565075 |
gggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
20565138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 6765690 - 6765632
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6765690 |
atttttttggtggtggtcgtggttcgaaccccggaccttacatattttatgcattgtcc |
6765632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 23756792 - 23756706
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||| || |||||||||| ||||||||| ||| ||||||||||||||||| |||||| |||| || ||| |||||| |||||||| |
|
|
| T |
23756792 |
attttttttgtggtgatcaaggttcgaactccgaaccttgcatattttatgtattgtctatatcaactgagctaagcttacgaagac |
23756706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 10735813 - 10735894
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| |||||||| ||||||| | || ||| ||||||||||| |
|
|
| T |
10735813 |
tttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaagctcacga |
10735894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 24548091 - 24548010
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |||| ||||| ||||||| || | || ||| |||||||||| |
|
|
| T |
24548091 |
atttttttggtggtgtccagggttcgaaccccggaccttgaatatattatggattgtccttaccaactgagctaagctcacg |
24548010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 33064045 - 33063984
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
33064045 |
gttcgaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacga |
33063984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 41187447 - 41187520
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| | ||||||||||||||||| |||||||||||||||||||||| || | || || ||||||||||| |
|
|
| T |
41187447 |
gtggtgaccggggttcgaaccccggactttgcatattttatgcattgtccataccaactaagctaagctcacga |
41187520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 12 - 64
Target Start/End: Complemental strand, 3904271 - 3904219
Alignment:
| Q |
12 |
ggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
3904271 |
ggtgatcagggtttgaaccccagaccttacatatattatgcattgtccctatc |
3904219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 9842205 - 9842265
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
9842205 |
ttcgaaccccaaaccttgcatattttatgcattgtccctaccaactgagctaagctcacga |
9842265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 27152433 - 27152353
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| ||||||||| | ||||||||||||| |||||||||||| ||||||||| |||||| | || ||| ||||||||| |
|
|
| T |
27152433 |
atttttttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattatccctaccaactgagttaagctcac |
27152353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 27411166 - 27411090
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| ||||||| |||| |||| || ||| ||||||||||| |
|
|
| T |
27411166 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgcaaggtccatatcaactgagctaagctcacga |
27411090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 29544706 - 29544646
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29544706 |
tttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcccta |
29544646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 2257032 - 2256969
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
2257032 |
gggttcgaaccccagaccttgcatatattatgcattgtccataccaactgagttaagctcacga |
2256969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 7302142 - 7302204
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| || ||| |||| |||||| |
|
|
| T |
7302142 |
gggttcgaacccag-accttgcatattttatgcattgtccctatcaactgagctaagttcacga |
7302204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 15654857 - 15654931
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||||||||| ||| || | || ||| |||||||||| |
|
|
| T |
15654857 |
ttggtggtg-tccgggttcgaaccccagaccttgcatattttatgcattatccttaccaactgagctaagctcacg |
15654931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 16390677 - 16390630
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16390677 |
ttggtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 17328006 - 17328069
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
17328006 |
gggtttgaaccccggaccttgcttattttatgcattgtcccaaccgactgagctaagctcacga |
17328069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 25186242 - 25186305
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |||| || ||| ||| ||||||| |
|
|
| T |
25186242 |
gggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaaactcacga |
25186305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 36359374 - 36359315
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| ||| |||||| |||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgtccaaatcaaccgagttaagctca |
36359315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 4056848 - 4056790
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| || | |||||| ||||||||| |
|
|
| T |
4056848 |
ttcgaactccggaccttgcatatattatgcattgtccttaccaaccgagctaagctcac |
4056790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 60
Target Start/End: Complemental strand, 4180776 - 4180718
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| ||||| ||| || ||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
4180776 |
tttttttggtagtggtcggggtttgaaccccggaccttgcatattttatgcattatccc |
4180718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 12124605 - 12124567
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgtcc |
12124567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 22709146 - 22709108
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22709146 |
gggtttgaaccccggaccttgcatattttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 24592827 - 24592909
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| | ||||| ||||||| |||||||||||| |||||||||||||||| | || ||| |||| |||||| |
|
|
| T |
24592827 |
atttttttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagttcacga |
24592909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 29798507 - 29798585
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||| || ||||||||||||| |||||| |||||||||||||||||| || | || ||| ||||||||||| |||| |
|
|
| T |
29798507 |
gtggtggtcggggttcgaacccctgaccttaaatattttatgcattgtccataccaactgagttaagctcacgaggacg |
29798585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 35820302 - 35820364
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
35820302 |
ggtttgaaccccggaccttgcatgtattatgcattgtccctaccaactgagctaagctcacga |
35820364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 39068708 - 39068770
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||| ||||||||| ||||||||| ||||||||||||| |||| || ||| |||||||||| |
|
|
| T |
39068708 |
gggttcaaaccccggatcttgcatatattatgcattgtccttatcaactgagctaagctcacg |
39068770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 80
Target Start/End: Original strand, 5168566 - 5168639
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||||||| || ||||| |||||||| ||||||||||| ||||||||| |||||||| || ||| |||||||| |
|
|
| T |
5168566 |
ttggtggtagtcggggtttgaaccccgaaccttgcatatattatgcattatccctatcaactgagttaagctca |
5168639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 10195652 - 10195725
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||| |||| || || ||||||||| ||||||||| ||| |||| || ||| ||||||||||| |
|
|
| T |
10195652 |
gtggtgatcagggtttgaactccagatcttgcatatattatgcattatccatatcaactgagctaagctcacga |
10195725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 12413554 - 12413493
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| ||||| | |||||||||||| ||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
12413554 |
gggtttgaacctcagaccttgcatatattatgcattgtccttatcaaccgagataaactcac |
12413493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 12425614 - 12425553
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| ||||| | |||||||||||| ||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
12425614 |
gggtttgaacctcagaccttgcatatattatgcattgtccttatcaaccgagataaactcac |
12425553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 23407008 - 23407057
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
23407008 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattgtcc |
23407057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 24033816 - 24033735
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| || |||||||||| | || ||||||||||||||||||||| ||| | |||||| ||||||||||| |
|
|
| T |
24033816 |
tttttttggtggtggtcggggttcgaacttcacactttgcatattttatgcattgtctctaccaaccgagctaagctcacga |
24033735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 27244704 - 27244655
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
27244704 |
gaccttgcatatattatgcattgtccctatcaactgagctaagctcacga |
27244655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 10560329 - 10560373
Alignment:
| Q |
13 |
gtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
10560329 |
gtgatcggggttcgaacccctgaccttgcatattttatacattgt |
10560373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 20455949 - 20455889
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || | | ||| ||||||||||| |
|
|
| T |
20455949 |
ttcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaagctcacga |
20455889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 42061455 - 42061415
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatg |
51 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42061455 |
tggtggtcagggttcgaaccctggaccttgcatattttatg |
42061415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 3708754 - 3708715
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
3708754 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
3708715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 11868662 - 11868701
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
11868662 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
11868701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 13143179 - 13143132
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
13143179 |
gtggtggtcagggttcaaacccccgaccttgcatatattatgcattgt |
13143132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 19976214 - 19976175
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatatt-ttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19976214 |
ggttcgaaccccggaccttgcatattattatgcattgtcc |
19976175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 25598562 - 25598601
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgtcc |
25598601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 31397776 - 31397831
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||| | ||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
31397776 |
ttggtggtggccggggttcgaatctcggaccttacatattttatgcattgtcccta |
31397831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 35360055 - 35360094
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
35360055 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
35360094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 41859913 - 41859874
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
41859913 |
gggtttgaaccccagaccttgcatattttatgcattgtcc |
41859874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 42791356 - 42791317
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
42791356 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
42791317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 44746608 - 44746569
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
44746608 |
gggttcgaaccccggactttgcatattttatacattgtcc |
44746569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 3113737 - 3113771
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
3113737 |
cccggaccttgcatattttatgcattgtccttatc |
3113771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 6723078 - 6723140
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| ||||||||||||| |||| |||||||| |||| || ||| ||| ||||||| |
|
|
| T |
6723078 |
ggttcgaaccctggaccttgcatatattatacattgtccatatcaactgagttaaactcacga |
6723140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 9547397 - 9547467
Alignment:
| Q |
8 |
tggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagct |
78 |
Q |
| |
|
|||||||| || ||||| ||||||| ||||||||||| ||||||||||||| |||| || ||| |||||| |
|
|
| T |
9547397 |
tggtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtccatatcaactgagttaagct |
9547467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 12124744 - 12124706
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
12124744 |
ggttcgaactccggaccttgcatatattatgcattgtcc |
12124706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 16204824 - 16204878
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| |||| || ||| ||||||||| |
|
|
| T |
16204824 |
aaccccagaccttgcatatattatgcattgtccttatcaactgagttaagctcac |
16204878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 16221349 - 16221383
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16221349 |
ttcgaaccccgaaccttgcatattttatgcattgt |
16221383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 21870885 - 21870935
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatatt-ttatgcattgtcc |
59 |
Q |
| |
|
|||||| || |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
21870885 |
gtggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtcc |
21870935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 24393306 - 24393244
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
24393306 |
gggttcgaacctcagaccttgcatatattatgcattgtccttaacaactgagctaagctcacg |
24393244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 28202346 - 28202296
Alignment:
| Q |
32 |
cggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
28202346 |
cggaccttacatatattatgcattgtccctatcaactgagctaagctcacg |
28202296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 30089109 - 30089047
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||||||||| | || ||| |||| |||||| |
|
|
| T |
30089109 |
ggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaagttcacga |
30089047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 30125713 - 30125651
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||||||||| | || ||| |||| |||||| |
|
|
| T |
30125713 |
ggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaagttcacga |
30125651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 34469861 - 34469935
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| |||||||||| | |||| || || ||||||||||| |
|
|
| T |
34469861 |
ggtggtggtcggggttcgaaccccggaccttgcataagctatgcattgttcttatcaactaagttaagctcacga |
34469935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 42066772 - 42066710
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||| || | || ||| ||||||||||| |
|
|
| T |
42066772 |
ggttcaaaccccggaccttgcatatattgtgcattgtccataccaactgagctaagctcacga |
42066710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 43356541 - 43356579
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43356541 |
agggttcgaacctcggaccttgcatatattatgcattgt |
43356579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 5137807 - 5137844
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
5137807 |
gttcgaaccccggaccttgcatatattatacattgtcc |
5137844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 82
Target Start/End: Complemental strand, 7052853 - 7052772
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatatt-ttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| | ||||| || |||||||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
7052853 |
tttttttggtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaagctcacg |
7052772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 7537165 - 7537108
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| |||||| || ||| ||| ||||||| |
|
|
| T |
7537165 |
gaactccggaccttgcatatattatgcattgttcctatcaactgagttaatctcacga |
7537108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 10811129 - 10811068
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| | | || ||| ||||||||| |
|
|
| T |
10811129 |
gggtttgaaccccggaccttgcatattttatgcgctgtcccaaccaactgagttaagctcac |
10811068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 12599855 - 12599904
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
12599855 |
gtggtggtcggggttcgaaccccagaccttgcatatattatgtattgtcc |
12599904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 22559056 - 22558999
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||| || || || |||| || ||||||| |||||||||||||||||| |
|
|
| T |
22559056 |
ttttattggtggtggtcgggttttgaactccagaccttgtatattttatgcattgtcc |
22558999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 27848233 - 27848184
Alignment:
| Q |
6 |
attggtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27848233 |
attggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 28771661 - 28771604
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | ||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
28771661 |
tttttttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcattgtcc |
28771604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 29734752 - 29734691
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||||| |||| || ||| ||| ||||| |
|
|
| T |
29734752 |
gggtttgaaccacggaccttgcatatattatgcattgtccatatcaactgagctaaactcac |
29734691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 34685966 - 34686031
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| | | || ||| ||||||||||||||| |
|
|
| T |
34685966 |
gttcgaaccccggaccttacatacattatgcattgtccaaaccaactgagctaagctcacgaagac |
34686031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 34708387 - 34708452
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| | | || ||| ||||||||||||||| |
|
|
| T |
34708387 |
gttcgaaccccggaccttacatacattatgcattgtccaaaccaactgagctaagctcacgaagac |
34708452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 35287671 - 35287708
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
35287671 |
aaccccggaccttgcatctattatgcattgtccctatc |
35287708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 38904132 - 38904059
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| | |||||| |||||| | ||||||||||| ||||||||||| ||||| | |||| ||||||||||| |
|
|
| T |
38904132 |
gtggtggttagggtttgaaccctgaaccttgcatatattatgcattgtatctatcaatcgagctaagctcacga |
38904059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 41778926 - 41778983
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | || |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
41778926 |
tttttttggtggtggccgggattcgaacctcggaccttgcatatattatgcattgtcc |
41778983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 42475110 - 42475147
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
42475110 |
gggttcgaacctcagaccttgcatattttatgcattgt |
42475147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 660813 - 660861
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| || ||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtcc |
660861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Original strand, 4557761 - 4557809
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||| |||||||| ||||| |||||||| ||||| |||||||||||| |
|
|
| T |
4557761 |
gtggtggtcagggtttgaaccacggaccttacatatattatgcattgtc |
4557809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 7206179 - 7206123
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||| | || ||| ||||||||||| |
|
|
| T |
7206179 |
aacctcggaccttgcatatattatgcattgtctctaccaactgagctaagctcacga |
7206123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 82
Target Start/End: Complemental strand, 10156096 - 10156016
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| || || ||||||| ||| ||||||||||| ||||| ||||||| || | || ||| |||||||||| |
|
|
| T |
10156096 |
tttttttggtggtggtcgggattcgaacaccgaaccttgcatatattatgtattgtccttaccaactgagctaagctcacg |
10156016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 17695174 - 17695122
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
|||| ||||||||| | ||||||||||| || |||||||||||||||||||| |
|
|
| T |
17695174 |
tttttttggtggtgtacggggttcgaacctcgaaccttgcatattttatgcat |
17695122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 18166904 - 18166955
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
18166904 |
ttggtggt-atctgggttcgaacccgggaccttgcatatatttatgcattgtc |
18166955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 18910531 - 18910595
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||| | |||||||||| |||||| |||||| || | || |||||||||||||| |
|
|
| T |
18910531 |
cagggttcgaaccctaggccttgcatatattatgcgttgtccttaccaactgagataagctcacg |
18910595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Original strand, 20990894 - 20990942
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||| || ||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
20990894 |
gtggtggtcggggtttgaaccctgaaccttgcatattttatgcattgtc |
20990942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 21482506 - 21482554
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
21482506 |
ttggtggtggtcggggttcaaaccccggaccttgcatatattatacatt |
21482554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 23405262 - 23405198
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||| |||||||| | || ||| |||||||||| |
|
|
| T |
23405262 |
cagggttcgaaccccgacccctgcatatattatgcaatgtccctaccaactgagctaagctcacg |
23405198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 25625790 - 25625738
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| || ||||| |||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
25625790 |
ttggtggtggtccgggtttgaaccccggaccttacatatattatgaattgtcc |
25625738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 29809384 - 29809328
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctc |
79 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||| | || ||| ||||||| |
|
|
| T |
29809384 |
ttcgaaccccgtacctttcatatattatgcattgtccctaccaactgagttaagctc |
29809328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 34977254 - 34977202
Alignment:
| Q |
31 |
ccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
34977254 |
ccggaccttgcatatattatgcattgtccataccaactgagttaagctcacga |
34977202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 36086018 - 36086069
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
36086018 |
ttggtggtg-tctgggttcgaacccgggaccttgcatatatttatgcattgtc |
36086069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 62
Target Start/End: Original strand, 37413193 - 37413221
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37413193 |
gaccttgcatattttatgcattgtcccta |
37413221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 40967386 - 40967434
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
40967386 |
accttgcatatattatgcattgtccttatcaactgagttaagctcacga |
40967434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 43043165 - 43043225
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| || | |||||| |||||||| |
|
|
| T |
43043165 |
gggtttgaaccccggaccttgcatacattatgcattgtctataccaaccgagctaagctca |
43043225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 74)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 781943 - 781864
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||| || |||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| || ||| |||||||| |
|
|
| T |
781943 |
attttttttgtggtggtcagggttcgaaccccagaccttgcatattttatacattgtccctatcaactgagttaagctca |
781864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 22522783 - 22522864
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||||| || | |||||| ||||||||||| |
|
|
| T |
22522783 |
tttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaaccgagctaagctcacga |
22522864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 37932393 - 37932328
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
37932393 |
cagggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacga |
37932328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 83
Target Start/End: Original strand, 11637563 - 11637635
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgtccataccaactgagttaagctcacga |
11637635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 33995851 - 33995784
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||| | | ||| ||||||||||||||| |
|
|
| T |
33995851 |
gggttcgaaccctggaccttgcatattttatacattgtccctaccaattgagttaagctcacgaagac |
33995784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 34191494 - 34191431
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
34191494 |
gggtttgaaccccggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacga |
34191431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 8544970 - 8545052
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || |||||| || | |||||||| ||||||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
8544970 |
attttttttgtggtggtcggagttcgaactccggaccttgcatatattatgcattgtccttatcaactgagttaagctcacga |
8545052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 88
Target Start/End: Complemental strand, 15889490 - 15889404
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||| ||||||||| || ||||| |||||| |||||||||||| |||||||||||||||| | || ||| ||||||||||| |||| |
|
|
| T |
15889490 |
tttttttggtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacg |
15889404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 18391660 - 18391594
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| || | || ||| |||||||| |||||| |
|
|
| T |
18391660 |
ggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagctaagctcaagaagac |
18391594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 6624855 - 6624774
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
6624855 |
tttttttggtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaagctcacga |
6624774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 32200453 - 32200510
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || || ||| ||||||||||| |
|
|
| T |
32200453 |
gaaccccggaccttgcatatattatgcattgtccctgtcaactgagctaagctcacga |
32200510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 6489081 - 6489005
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| | ||||| ||||||| |||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
6489081 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
6489005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 28207190 - 28207130
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
28207190 |
ttcgaacctcggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
28207130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 34436925 - 34436849
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| | ||||| ||||||||| |||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
34436925 |
ttggtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
34436849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 39980582 - 39980506
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || ||||| |||| ||||||||||||||||||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
39980582 |
ttggtggtggtcggggtttgaactccggaccttgcatattttatgcattatccataccaactgagctaagctcacga |
39980506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 3671279 - 3671208
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtat |
91 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||| ||| |||| || ||| |||||||||| |||||||| |
|
|
| T |
3671279 |
gggttcgaaccctggaccttgcatatattatacattatccttatcaactgagttaagctcacggagacgtat |
3671208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 10704337 - 10704392
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | || ||| ||||||||| |
|
|
| T |
10704337 |
gaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcac |
10704392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 20175899 - 20175825
Alignment:
| Q |
8 |
tggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||| |||| |||||||||||| | |||||||||||||||||||||| ||| | || ||| ||||||||||| |
|
|
| T |
20175899 |
tggtggtg-tcagtgttcgaaccccgaatcttgcatattttatgcattgtctctaacaactgagttaagctcacga |
20175825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 26409314 - 26409247
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| || | || ||| |||||||||| |||| |
|
|
| T |
26409314 |
gggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctaagctcacggagac |
26409247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 40715949 - 40716012
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |||| | ||| ||||||||||| |
|
|
| T |
40715949 |
gggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaagctcacga |
40716012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 5485246 - 5485184
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
5485246 |
ggttagaaccccggacattgcatatattatgcattgtccctaccaactgagctaagctcacga |
5485184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 12611036 - 12611074
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12611036 |
ggttcgaaccccagaccttgcatattttatgcattgtcc |
12611074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 25509371 - 25509309
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| || ||| ||||||||||| |
|
|
| T |
25509371 |
ggttcgaacctcggaccttgcatattatatgcattgtccctactaactgagttaagctcacga |
25509309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 35270682 - 35270744
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
35270682 |
ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacga |
35270744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 2053089 - 2053048
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2053089 |
cagggttcgaactccggaccttgtatattttatgcattgtcc |
2053048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 10227843 - 10227778
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| || || ||| ||||||||||| |
|
|
| T |
10227843 |
cagggatcgaaccccggaccttgcatatttcatgcattgtccttacgaactgagttaagctcacga |
10227778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 16701571 - 16701644
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| ||| |||||||||||||||| |||| ||||||||||| | || ||| ||||||||||| |
|
|
| T |
16701571 |
gtggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctaccaactgagctaagctcacga |
16701644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 18331762 - 18331729
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18331762 |
gaaccccggaccttgcatattttatgcattgtcc |
18331729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 18589850 - 18589930
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||| ||||||||||| | || | || ||| ||||||||||| |
|
|
| T |
18589850 |
tttttttggtggtgatc-gggtttaaaccccggaccttgcatatattatgcattgttcataccaactgagttaagctcacga |
18589930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 32234840 - 32234784
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| || ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
32234840 |
tttttttggtggtggtcggggtttgaaccccg-accttgcatattttatgcattgtcc |
32234784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 91
Target Start/End: Complemental strand, 17708120 - 17708064
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgtat |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||| || ||| || |||||||| ||||||| |
|
|
| T |
17708120 |
accttgcatattttatgcattgtccatatcaactgagttatgctcacgaggacgtat |
17708064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 22555305 - 22555229
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || ||||| || ||||||||||||||||| |||||||||||| || | || ||| ||||||||||| |
|
|
| T |
22555305 |
ttggtggtggtcggggtttgattcccggaccttgcatattatatgcattgtccataccaactgagttaagctcacga |
22555229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 23118038 - 23118114
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||| ||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
23118038 |
ttggtggtgtccagagttcgaaccccaaaccttacatatattatgcattgtccttatcaactgagttaagctcacga |
23118114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 26655538 - 26655486
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26655538 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtcc |
26655486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 26927123 - 26927071
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26927123 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtcc |
26927071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 34702553 - 34702489
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
34702553 |
caggattcgaaccccggacctttcatatattatgcattgtccttaccaactgagttaagctcacg |
34702489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 6424903 - 6424954
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgag |
71 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||| | |||||| |
|
|
| T |
6424903 |
gggtttgaaccccggaccttgtatatattatgcattgtccctaccaaccgag |
6424954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 16579364 - 16579411
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
16579364 |
gtggtggtcagggtttgaaccacggaccttgcatatattatgcattgt |
16579411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 18877805 - 18877766
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
18877805 |
gggttcgaaccctggaccttacatattttatgcattgtcc |
18877766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 25604003 - 25604062
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||| |||| || ||| |||||||||| |
|
|
| T |
25604003 |
ttcgaaccccgaaccttgcatatattatgcactgtccatatcaactgagctaagctcacg |
25604062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 32339814 - 32339759
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||| ||||||||| | || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32339814 |
tttttttggtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 37462172 - 37462133
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
37462172 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
37462133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 42168945 - 42169012
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| || | || ||||||| |||||| |||| |
|
|
| T |
42168945 |
gggttcgaaccccagaccttgcatatactatgcattgtccttaccaactgagataaactcacggagac |
42169012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 11720967 - 11720894
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||| | ||||| |||||||| ||||||||||| |||||||||||||||| | || ||| ||||||||| |
|
|
| T |
11720967 |
ttggtggtggccggggtttgaaccccg-accttgcatatattatgcattgtccctaccaactgagttaagctcac |
11720894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 18789097 - 18789059
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18789097 |
gggtttgaaccccgaaccttgcatattttatgcattgtc |
18789059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 26166803 - 26166761
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||| |
|
|
| T |
26166803 |
tcagggtttgaaccctggaccttgcatatttgatgcattgtcc |
26166761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 41630102 - 41630156
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||| | ||||| ||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41630102 |
gtggtgaccggggtttgaatcccgaaccttgcatatattatgcattgtccctatc |
41630156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 42473954 - 42473892
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| || ||| | ||| ||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgttccaatcaattgagctaagctcacga |
42473892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 3445253 - 3445310
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
3445253 |
gaaccccggaccttgcatacattatgcattgtccttaccaactgagctaagctcacga |
3445310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 11647268 - 11647219
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
11647268 |
gtggtggtcaggattcgaaccccaaaccttgcatatattatgcattgtcc |
11647219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 13864415 - 13864342
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||| ||||| ||||| | || | || ||| ||||||||||| |
|
|
| T |
13864415 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgttcataccaactgagttaagctcacga |
13864342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 17672282 - 17672363
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||| | ||||||||||| ||||| |||| |||||||| |||| |||| || ||| ||||||||||| |
|
|
| T |
17672282 |
tttttttggtggtgatcgagattcgaaccccgaaccttatatatattatgcatcgtccttatcaactgagctaagctcacga |
17672363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 18872738 - 18872665
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| |||| ||||||||||| ||||||||||| ||||||||| ||| || | | ||| ||||||||||| |
|
|
| T |
18872738 |
gtggtgaccaggattcgaaccccgaaccttgcatatattatgcattttccataacaagtgagttaagctcacga |
18872665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 20688119 - 20688062
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| ||| ||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
20688119 |
tttttttggtggtggccagagtttgaactccggaccttgcatatattatgcattgtcc |
20688062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 21209617 - 21209576
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcata-ttttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
21209617 |
gttcgaaccccggactttgcatatttttatgcattgtcccta |
21209576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 87
Target Start/End: Original strand, 31958455 - 31958536
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| |||||| || || |||| ||||||||||| |||| ||||| |
|
|
| T |
31958455 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatttatgtgttatctttatcaaccgagataagttcactaagac |
31958536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 32858717 - 32858668
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
32858717 |
gaccttgcatattttatgcattgtccataccaacggagctaagctcacga |
32858668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 33654795 - 33654746
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
33654795 |
gaccttgcatatattatgcattgtccctaccaactgagttaagctcacga |
33654746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 60
Target Start/End: Complemental strand, 33928693 - 33928660
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
33928693 |
aaccccggaccttgcatatattatgcattgtccc |
33928660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 41650951 - 41651008
Alignment:
| Q |
32 |
cggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgt |
89 |
Q |
| |
|
|||||||||||||| ||||||||||||| || | || ||| ||||||||||| ||||| |
|
|
| T |
41650951 |
cggaccttgcatatattatgcattgtccataccaactgagttaagctcacgatgacgt |
41651008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 42613210 - 42613243
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
42613210 |
gaaccccagaccttgcatattttatgcattgtcc |
42613243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 1060691 - 1060627
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||| |||||||| || ||| ||||| ||||| |
|
|
| T |
1060691 |
gggttcgaaccccgaactttgcatatatttatgcattatccctatcaactgagctaagcccacga |
1060627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 1257154 - 1257190
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattg |
56 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1257154 |
gggttcgaaccccagaccttacatattttatgcattg |
1257190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 83
Target Start/End: Original strand, 5107236 - 5107308
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||| ||||||||| | | || | || ||| ||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattattcataccaactgagttaagctcacga |
5107308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 5974213 - 5974288
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| || || ||||| | |||||||||||| ||||||||| |||||||| || ||| |||| |||||| |
|
|
| T |
5974213 |
ttggtggtgatc-ggatttgaacctcagaccttgcatatattatgcattatccctatcgactgagttaagttcacga |
5974288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 6894156 - 6894120
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
6894156 |
ggttcgaaccccgaaccttgcatattttttgcattgt |
6894120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 10706020 - 10705980
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10706020 |
gggtttgaaccccagaccttgcatattttatgtattgtccc |
10705980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 25607060 - 25607096
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
25607060 |
gttcgaaccccagaccttgcatatattatgcattgtc |
25607096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 29695089 - 29695013
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || ||||| ||||| || ||||| ||||| ||||||||||||| |||| || ||| |||| |||||| |
|
|
| T |
29695089 |
ttggtggtggtcggggtttgaaccacgaaccttacatatattatgcattgtccatatcaactgagttaaggtcacga |
29695013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Complemental strand, 30329161 - 30329125
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
30329161 |
gttcgaaccccggaccttgcgtatattatgcattgtc |
30329125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 31708147 - 31708183
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31708147 |
ggttcgaaccccagaccttgcatatattatgcattgt |
31708183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 39914970 - 39914923
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39914970 |
tggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgtcc |
39914923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 40782430 - 40782354
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || |||||| |||||| |||||| ||||| ||||| ||||| ||||| || ||| ||||||||||| |
|
|
| T |
40782430 |
ttggtggtggtcggggttcaaacccctgaccttacatatattatgtattgttcctattgactgagttaagctcacga |
40782354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 43354506 - 43354442
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| |||||| ||||| || ||| |||| |||||| |
|
|
| T |
43354506 |
gggttcgaaccccggactttgcatatatttatgtattgtctctatcaactgagctaagatcacga |
43354442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 91)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 28244094 - 28244167
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| | || | || ||| ||||||||||| |
|
|
| T |
28244094 |
gtggtgatcggggttcgaaccccggaccttgcatattttatgcattgttcataccaactgagttaagctcacga |
28244167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 44579697 - 44579634
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
44579697 |
gggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
44579634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 25340905 - 25340987
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| | ||||| |||||||||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
25340905 |
atttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
25340987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 7738724 - 7738667
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
7738724 |
gaaccccggaccttgcatattttatgcattgtccctaccaactgagttaagctcacga |
7738667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 32629139 - 32629079
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | || ||| |||||||||| |
|
|
| T |
32629139 |
gttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacg |
32629079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 11508483 - 11508546
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||| ||||||| | ||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
11508483 |
gggttcgaaccccggaccctgcatatatcatgcattgtccatatcaaccgagctaagctcacga |
11508546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 52456561 - 52456507
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||| || |||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52456561 |
attttttttgtggtggtcagggttcgaaccccggaccttacatattttatgcatt |
52456507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 4216382 - 4216462
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| ||||||||||| ||||||||||||| |||| || ||| |||| |||||| |
|
|
| T |
4216382 |
tttttttggtggtgtccagggttcgaaccccg-accttgcatatattatgcattgtccttatcaactgagctaagttcacga |
4216462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 7464481 - 7464554
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctaccaactgagttaagctcacga |
7464554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 34899176 - 34899116
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||| ||| ||||| || ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34899176 |
tttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcattgtcccta |
34899116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 45432011 - 45431967
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45432011 |
cagggtttgaaccccggaccttgcatatattatgcattgtcccta |
45431967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 20370281 - 20370344
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
20370281 |
gggttcgaaccctaaaccttgcatattttatgcattgtccatatcaactgagctaagctcacga |
20370344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 21506758 - 21506821
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
21506758 |
gggttcaaaccccagaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
21506821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 38130941 - 38131020
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
38130941 |
tttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagttaagctcac |
38131020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 60
Target Start/End: Complemental strand, 3582861 - 3582803
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| ||||||||| ||| |||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
3582861 |
tttttttggtggtggtcatggtttgaacctcggaccttgcatattttatgcattctccc |
3582803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 5239858 - 5239792
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||| ||||| || | | ||||||||||| |
|
|
| T |
5239858 |
cagggttcgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagctcacga |
5239792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 10922308 - 10922370
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||| |||||||||| ||||||||| |||||||||||||||| | || ||| |||||||||| |
|
|
| T |
10922308 |
gggtttgaaccccggatcttgcatatattatgcattgtccctaccaactgagttaagctcacg |
10922370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 13829077 - 13829119
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
13829077 |
gggttcgaaccccagaccttgcatatattatgcattgtcccta |
13829119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 25505683 - 25505740
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||||| || ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
25505683 |
atttttttggtggtg-tccgggttcgaaccccagaccttgcatatattatgcattgtcc |
25505740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 33745160 - 33745098
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |||| | ||| |||||||||| |
|
|
| T |
33745160 |
gggtttgaaccccagaccttgcatattttatgcattgtccatatcaattgagctaagctcacg |
33745098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 48263964 - 48264026
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||||||||||||||| || ||| ||||||||| |
|
|
| T |
48263964 |
gggttcgaatcccgaaccttgcatatatttatgcattgtccctatcaactgagctaagctcac |
48264026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 1149067 - 1149132
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
1149067 |
cagggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaagctcacga |
1149132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 8127534 - 8127461
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| ||| |||| ||||||| ||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
8127534 |
gtggtggtcatggtttgaaccccaaaccttgcatattttatgcattgtccttaccaactgagttaagctcacga |
8127461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 16792955 - 16793012
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| |||||||||| | ||||| |||||| ||||||||||||| |||||||||||| |
|
|
| T |
16792955 |
atttttttggtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtc |
16793012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 41817578 - 41817521
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
41817578 |
tttttttggtggtggctagggtttgaaccccggaccttgcatatattatgcattgtcc |
41817521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 49097331 - 49097270
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| | ||| | || ||||||||||||||| |
|
|
| T |
49097331 |
gttcgaactccgaaccttgcatattttatgcattggctctaccaactgagataagctcacga |
49097270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 3755393 - 3755337
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| | |||||| ||| ||||||| |
|
|
| T |
3755393 |
aaccctggaccttgcatatattatgcattgtccctaccaaccgagctaaactcacga |
3755337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 7626467 - 7626499
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7626467 |
gaaccccggaccttgcatattttatgcattgtc |
7626499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 14827579 - 14827523
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
14827579 |
aaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacga |
14827523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 16663233 - 16663297
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| ||| || | || ||||||| ||||| |
|
|
| T |
16663233 |
tcagggtttgaaccccggaccttgcatatattatgcattatccataccaactgagataatctcac |
16663297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 19468509 - 19468445
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| || | || ||| ||||||||| ||||| |
|
|
| T |
19468509 |
ttcgaaccacggaccttgcatatattatgcattgtccataccaactgagttaagctcacaaagac |
19468445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 21331420 - 21331480
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
21331420 |
ttcgaaccccgaaccttgcatatattatgcattgtccataacaactgagctaagctcacga |
21331480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 23147967 - 23148039
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||| ||||| ||||||| || | || ||| ||||||||| |
|
|
| T |
23147967 |
ggtggtgttcggggttcgaaccccggacctcgcatatattatgtattgtccttaccaactgagctaagctcac |
23148039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 27065732 - 27065772
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
27065732 |
gggtttgaaccctggaccttgcatattttatgcattgtccc |
27065772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 34442447 - 34442487
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
34442447 |
gggtttgaaccccggaccttacatattttatgcattgtccc |
34442487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 47536486 - 47536522
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47536486 |
gaacctcggaccttgcatattttatgcattgtcccta |
47536522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 52119437 - 52119377
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| || | || ||| |||||||| |
|
|
| T |
52119437 |
gggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaagctca |
52119377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 52576019 - 52575971
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||| || || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
52576019 |
ggtggtggtcgggattcgaaccccagaccttgcatattttatgcattgt |
52575971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 82
Target Start/End: Complemental strand, 53208049 - 53207969
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| |||||||||||||| |||||||||||| |||||||||| || || | || ||| |||||||||| |
|
|
| T |
53208049 |
ttttgttggtggtgtcaagggttcgaaccccagaccttgcatatattatgcattgcccttaccaactgagctaagctcacg |
53207969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 334847 - 334882
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
334847 |
gggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 916500 - 916461
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
916500 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 10617634 - 10617551
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| || |||||| ||||||||||||||| ||||||| |||| |||||||||| ||| |||| || ||| ||||||||||| |
|
|
| T |
10617634 |
attttttttgtggtgtccagggttcgaaccccagaccttgtatatatttatgcattatccatatcaactgagctaagctcacga |
10617551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 12976605 - 12976664
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||||| || ||| ||| |||||| |
|
|
| T |
12976605 |
ttcgaatcccagaccttgcatatattatgcattgtccctatcaactgagttaaactcacg |
12976664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 60
Target Start/End: Complemental strand, 20018257 - 20018218
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20018257 |
ggtttgaaccccagaccttgcatattttatgcattgtccc |
20018218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 22722473 - 22722426
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
22722473 |
gtggtggtcggggtttgaacctcggaccttgcatattttatgcattgt |
22722426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 28266777 - 28266738
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28266777 |
gggtacgaaccccggaccttgcatatattatgcattgtcc |
28266738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 32484339 - 32484272
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||| || | || ||| ||| ||||||||||| |
|
|
| T |
32484339 |
gggtttgaaccccggatcttgcatattttaagcattgtccataccaactgagttaaactcacgaagac |
32484272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 32843262 - 32843325
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
32843262 |
gggtttgaaccccagaccttgcatattttatgcattgtccaaaccaactgagctaagctcacga |
32843325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 35191817 - 35191856
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
35191817 |
gggttcgaaccccagaccttgcatatattatgcattgtcc |
35191856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 60
Target Start/End: Original strand, 38034810 - 38034849
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
38034810 |
ggtttgaaccccggaccttgcatattttatgtattgtccc |
38034849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 44075156 - 44075195
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
44075156 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
44075195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 46226016 - 46226063
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| || |||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
46226016 |
tggtgttcggggttcgaactccggaccttgcatatattatgcattgtc |
46226063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 5941284 - 5941362
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||| |||||||||||| ||| ||| ||||||| ||||||||||| | || | || ||| |||||||||||||||| |
|
|
| T |
5941284 |
gtggtggtcagggttcgaattccgaaccatgcatatattatgcattgttcataccaactgagttaagctcacgaagacg |
5941362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 15881150 - 15881088
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||| | ||||||||||| ||||||||||| |||| || || ||||||||||| |
|
|
| T |
15881150 |
ggttcgaaccccgaatcttgcatatttaatgcattgtccatatcaacttagctaagctcacga |
15881088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Original strand, 18870738 - 18870788
Alignment:
| Q |
33 |
ggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
18870738 |
ggaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
18870788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 20671824 - 20671882
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
20671824 |
attttttttgtggtgtgcagggttcgaaccccggaccgtgcatgtattatgcattgtcc |
20671882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 25727956 - 25728006
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| || || || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
25727956 |
ggtggtggtcgggatttgaaccccggaccttgcatatattatgcattgtcc |
25728006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 27185537 - 27185475
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||| |||||||||| | || ||| ||||||||||| |
|
|
| T |
27185537 |
ggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaagctcacga |
27185475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 38894095 - 38894061
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
38894095 |
ttcgaaccccggaccttgcatattttatacattgt |
38894061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 46226078 - 46226119
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
46226078 |
gggttcgaaccc-ggaccttgcatatattatgcattgtcccta |
46226119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 48849763 - 48849801
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
48849763 |
gggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 53996357 - 53996299
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
53996357 |
ttcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcac |
53996299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 3695679 - 3695720
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
3695679 |
tcagggtttgaaccccgaacctttcatattttatgcattgtc |
3695720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 4601923 - 4601866
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
4601923 |
tttttttggtggtggccggggtttgaaccccggaccttgcatttattatgcattgtcc |
4601866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 14160278 - 14160315
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
14160278 |
gggttcgaaccccggactttgcatatattatgcattgt |
14160315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 22251447 - 22251524
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgca-ttgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| | |||||||||||||||||| ||||||| ||||||| |||||| || | || ||| ||||||||||| |
|
|
| T |
22251447 |
ttggtggtggccggggttcgaaccccggaccgtgcatatattatgcatttgtccataccaactgagttaagctcacga |
22251524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 25902859 - 25902774
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||| ||||||||| || |||||||||||| |||||||||||| |||| |||| ||| || | ||| || |||||||| |||||| |
|
|
| T |
25902859 |
tttttttggtggtgtccaaggttcgaaccccagaccttgcatatattatacattatccttaccaaccaagctaagctcatgaagac |
25902774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 32753883 - 32753826
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
32753883 |
gaaccccgggccttgtatatattatgcattgtccctatcaactgagtcaagctcacga |
32753826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 32909307 - 32909364
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || || ||| ||||||||||| |
|
|
| T |
32909307 |
gaacccaggaccttgcatattttatgcattgtccatactaactgagttaagctcacga |
32909364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 35210114 - 35210163
Alignment:
| Q |
3 |
tttattggtggtgatcagggttcgaaccccggaccttgcatattttatgc |
52 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
35210114 |
tttattggtggtggccgaggtttgaaccccggaccttgcatattttatgc |
35210163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 42886510 - 42886547
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
42886510 |
ggtttgaaccccgaaccttgcatattttatgcattgtc |
42886547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 43777066 - 43777123
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||| | || ||| ||||||||||||||| |
|
|
| T |
43777066 |
cccgaaccttgcatatattatgcatggtccctaccaactgagctaagctcacgaagac |
43777123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 44582786 - 44582749
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatatt-ttatgcattg |
56 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44582786 |
gggttcgaaccccggaccttgcatattattatgcattg |
44582749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 48315030 - 48315087
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
48315030 |
gaaccccggaccttgcatatattatgcattatccttaccaactgagctaagctcacga |
48315087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 62
Target Start/End: Complemental strand, 48511302 - 48511269
Alignment:
| Q |
29 |
ccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
48511302 |
ccccggaccttgcatatattatgcattgtcccta |
48511269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 48656900 - 48656937
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgtc |
48656937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 986940 - 986992
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||| || ||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
986940 |
ttggtagtggtcggggtttgaaccctggaccttgcatattttatacattgtcc |
986992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 1111841 - 1111885
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
1111841 |
gggtttgaaccccagaccttgcatatattatgtattgtccctatc |
1111885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 4825399 - 4825363
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
4825399 |
ggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 7202897 - 7202953
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| ||||| |||| | ||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
7202897 |
atttttttggtagtgaccggggtttgaaccctgaaccttgcatattttatgcattgt |
7202953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 7745064 - 7745104
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
7745064 |
gggttcgaaccgcggaccttgtatatattatgcattgtccc |
7745104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 19983996 - 19984036
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| |||| |
|
|
| T |
19983996 |
gggttcgaaccccagaccttgcatattttgtgcattatccc |
19984036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 21914071 - 21914131
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| || | || ||| |||||||| |
|
|
| T |
21914071 |
gggttcgaaccccataccttgcatatattatgcattgtccttaccaactgagttaagctca |
21914131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 58
Target Start/End: Original strand, 30229536 - 30229564
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30229536 |
cccggaccttgcatattttatgcattgtc |
30229564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 40575615 - 40575647
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
40575615 |
gaaccccggaccttgcatatattatgcattgtc |
40575647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 87
Target Start/End: Complemental strand, 43352780 - 43352708
Alignment:
| Q |
15 |
gatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| ||| || |||| |||||| |||| ||||| |||| |
|
|
| T |
43352780 |
gatcagggttcgaaccccggaccttgtatataatatgtattatctttatcaaccgagttaagttcacggagac |
43352708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 45096087 - 45096043
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||||| |||| |
|
|
| T |
45096087 |
gggttcgaaccacagaccttgcatatattatgcattgtccttatc |
45096043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 47039498 - 47039426
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||| || || ||||||||||| || |||||||| ||||||||||||| |||| | ||| |||||||||| |
|
|
| T |
47039498 |
gtggtggtcgggattcgaaccccgaactttgcatatattatgcattgtccttatcatctgagttaagctcacg |
47039426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Complemental strand, 53162244 - 53162196
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||||||||||| |
|
|
| T |
53162244 |
accttgcatattttatgcattgtccatatcaattgagctaagctcacga |
53162196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 53633620 - 53633680
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
53633620 |
ttcgaaccccggaccttacatatattatgcattatccttaccaactgagttaagctcacga |
53633680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 54113402 - 54113338
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcata-ttttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
54113402 |
gggttcgaacccgggaccttgcatacatttatgcattgtctatatcaactgagctaagctcacga |
54113338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 1589 - 1527
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || | || ||| |||||||||| |
|
|
| T |
1589 |
gggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacg |
1527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 91)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 8084507 - 8084449
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8084507 |
atttttttggtggtggccggggttcgaaccccggaccttgcatattttatgcattgtcc |
8084449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 580916 - 580989
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || |||||||||| ||||| ||||||||||||||||||||||| || | |||||| ||||||||||| |
|
|
| T |
580916 |
gtggtggtcggggttcgaacgccggatcttgcatattttatgcattgtccataccaaccgagctaagctcacga |
580989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 19416593 - 19416512
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
19416593 |
tttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
19416512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 48527248 - 48527189
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |||| || |||||||||||||| |
|
|
| T |
48527248 |
ttcgaactccggaccttgcatatattatgcattgtccttatcaactgagataagctcacg |
48527189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 46987147 - 46987086
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
46987147 |
gggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcac |
46987086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 6384930 - 6384851
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||| ||||||||| |||||||||||||| |||||||||||| ||||||||||||| ||| || ||| ||||||||| |
|
|
| T |
6384930 |
tttttttggtggtgtctagggttcgaaccccagaccttgcatatattatgcattgtccttattaactgagttaagctcac |
6384851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 10244788 - 10244725
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacga |
10244725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 20243336 - 20243253
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatatt-ttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| | |||||| |||||||||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
20243336 |
atttttttggtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaagctcacga |
20243253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 45046197 - 45046284
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgt |
89 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||||||||| ||||| | ||||| |||| || ||| || |||||||| ||||| |
|
|
| T |
45046197 |
tttttttggtggtggtcagagtttgaaccccggaccttgcatatattatgtactgtccatatcaactgagctatgctcacgaggacgt |
45046284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 6023389 - 6023307
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| || ||||| |||||||| ||||||||||||||| ||||||||| | | || ||| ||||||||||| |
|
|
| T |
6023389 |
atttttttggtggtggtcggggtttgaaccccgaaccttgcatattttaagcattgtccaaaccaactgagctaagctcacga |
6023307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14671250 - 14671192
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| || ||||||||| || |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
14671250 |
attttttttgtggtgatcgggattcgaaccccggaccttgtatatattatgcattgtcc |
14671192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 17816584 - 17816518
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||| ||||| || | | ||||||||||| |
|
|
| T |
17816584 |
cagggttcgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagctcacga |
17816518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 18773746 - 18773800
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18773746 |
gtggtggtcggggtttgaaccccggaccttacatattttatgcattgtccatatc |
18773800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 39801786 - 39801704
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| | ||||||| |||||||| ||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
39801786 |
atttttttggtggtggttggggttcgtaccccggatcttgcatatattatgcattgtccataccaactgagctaagctcacga |
39801704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 47155104 - 47155146
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
47155104 |
gggttcgaaccctggaccttgcatatattatgcattgtcccta |
47155146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 1285059 - 1285132
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||| | |||||||||||| ||||||||| ||||||||||| |||||| || ||| ||| ||||||| |
|
|
| T |
1285059 |
gtggtggtcagagctcgaaccccggatcttgcatatattatgcattgttcctatcaactgagttaaactcacga |
1285132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 10026073 - 10025992
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| || ||||| ||||||| ||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
10026073 |
tttttttggtggtggtcggggtttgaaccccataccttgcatattttatgcattgtccaaaccaactgagttaagctcacga |
10025992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18505667 - 18505720
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
18505667 |
cccggatcttgcatattttatgcattgtccctaccaactgagctaagctcacga |
18505720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 18714527 - 18714470
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
18714527 |
tttttttggtggtgtacggggtttgaaccccggaccttgcatatattatgcattgtcc |
18714470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 33610927 - 33610992
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| || | || ||| |||||||| |||||| |
|
|
| T |
33610927 |
gttcgaactccggaccttgcatatattatgcattgtccgtaacaactgagctaagctcatgaagac |
33610992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 42829240 - 42829297
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
42829240 |
gaaccccggagcttgcatatattatgcattgtccctatcaactgagtcaagctcacga |
42829297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 43539104 - 43539165
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||||| |||||| || ||| ||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaagctcac |
43539165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 87
Target Start/End: Original strand, 44406862 - 44406923
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | | || ||| ||||||||| ||||| |
|
|
| T |
44406862 |
gaacctcggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacaaagac |
44406923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 48103680 - 48103737
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
48103680 |
gaaccccgaaccttgcatattttatgcattgtcccaaccaactgagttaagctcacga |
48103737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 2618737 - 2618701
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2618737 |
ttcgaaccccggaccttgcatatattatgcattgtcc |
2618701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 5579765 - 5579693
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||| || ||||| ||||||| |||||||||||| ||||||| |||||||| | || ||| ||||||||| |
|
|
| T |
5579765 |
ggtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaagctcac |
5579693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 7872735 - 7872787
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| | ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
7872735 |
ttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtcc |
7872787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 27545012 - 27544956
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| || | || |||||||||||||| |
|
|
| T |
27545012 |
gaaccccggaccttgcatatattatacattgtccttaccaactgagataagctcacg |
27544956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 32315294 - 32315222
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||||| ||||| | ||||| |||| || ||| |||||||||| |
|
|
| T |
32315294 |
gtggtggtcagggttcgaaccctgaaccttgcatatattatgtaatgtccttatcaactgagttaagctcacg |
32315222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 33473508 - 33473560
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
33473508 |
ttggtggtggccagggttggaaccctggaccttgcatatattatgcattgtcc |
33473560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 36121713 - 36121649
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcat-tgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||| | | |||||| | ||||||||| |
|
|
| T |
36121713 |
gggtttgaaccccggaccttgcatattttatgcatatgtcccaaccaaccgagctcagctcacga |
36121649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 36428221 - 36428146
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || || |||||||||||||| |||||||||||||||| |||||||| || | || ||| ||||||||||| |
|
|
| T |
36428221 |
ttggtgttggtcggggttcgaaccccg-accttgcatattttatacattgtccataccaactgagttaagctcacga |
36428146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 83
Target Start/End: Complemental strand, 44454558 - 44454510
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
44454558 |
accttgcatattttatgcattgtccctaccaactgagttaagctcacga |
44454510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Original strand, 1079698 - 1079729
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1079698 |
gaaccccggaccttgcatattttatgcattgt |
1079729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 3671903 - 3671848
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||| || ||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
3671903 |
ttttattggtggtggtcggggtttgaactccagaccttgcatatattatgcattgt |
3671848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 6781868 - 6781829
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
6781868 |
gggtttgaaccctggaccttgcatattttatgcattgtcc |
6781829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 7908654 - 7908615
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7908654 |
gggttcgaaccccgaaccttacatattttatgcattgtcc |
7908615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 11893214 - 11893151
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||| ||||||||| |||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
11893214 |
atttttttggtggtggtcagggtttaaaccgtagaccttgcatattttatgcattgtccatatc |
11893151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 19599206 - 19599167
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
19599206 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
19599167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 20103454 - 20103521
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||||||||||||||| | || ||||||||||||| || | || ||| |||||||||| |||| |
|
|
| T |
20103454 |
gggttcgaaccccggaccttgtaaatattatgcattgtccttaccaactgagttaagctcacggagac |
20103521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 20135142 - 20135225
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| | |||||||||||| ||||||||||||| ||||| ||||||| |||| || ||| ||||||||||| |
|
|
| T |
20135142 |
atttttttggtggtgtccggggttcgaacccgggaccttgcatatatttatacattgtctttatcaactgagctaagctcacga |
20135225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 20763215 - 20763176
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
20763215 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
20763176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 27462436 - 27462475
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
27462436 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
27462475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 29488781 - 29488742
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
29488781 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
29488742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 33232397 - 33232436
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
33232397 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
33232436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 34284539 - 34284578
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
34284539 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
34284578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 40808159 - 40808222
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||| | | || ||| ||||||||||| |
|
|
| T |
40808159 |
gggtttgaaccccggaccttgcatattttatgcactgtccaaaccaactgagttaagctcacga |
40808222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 41029330 - 41029271
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| || | || ||| |||||||||| |
|
|
| T |
41029330 |
ttcgaaccccggaccttgcatatattatacattgtccttaccaactgagctaagctcacg |
41029271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 43680990 - 43681053
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| ||| || ||| ||| ||||||| |
|
|
| T |
43680990 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaactcacga |
43681053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Original strand, 44595644 - 44595675
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44595644 |
gaaccccggaccttgcatattttatgcattgt |
44595675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 27 - 62
Target Start/End: Original strand, 48629072 - 48629107
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48629072 |
aaccccggaccttgcatatattatgcattgtcccta |
48629107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 394348 - 394394
Alignment:
| Q |
8 |
tggtggtgatcagggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
394348 |
tggtggtggccagtgttcgaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 3830129 - 3830087
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
3830129 |
gggtttgaaccctggaccttgcatatattatgcattgtcccta |
3830087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 7670494 - 7670428
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| | | | || ||| ||||||||||||||| |
|
|
| T |
7670494 |
ggtttgaaccccggaccttgcatatattatgcattgttcaaaccaactgagctaagctcacgaagac |
7670428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 8290459 - 8290509
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatatt-ttatgcattgtcc |
59 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8290459 |
gtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtcc |
8290509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 19050417 - 19050483
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||||| ||||| || | | ||||||||||| |
|
|
| T |
19050417 |
cagggtttgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagctcacga |
19050483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 20085759 - 20085797
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
20085759 |
gggtttgaaccccggaccttgcatatattatgcattgtc |
20085797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 24225982 - 24226020
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
24225982 |
ggttcgaacctcggaccttacatattttatgcattgtcc |
24226020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 27833390 - 27833440
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| || ||||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
27833390 |
ggtggtggtcggggtttgaaccccggaccttacatatattatgcattgtcc |
27833440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 88
Target Start/End: Complemental strand, 35103543 - 35103489
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||||||||||||||||||||||||| | | || ||| ||||||||||| |||| |
|
|
| T |
35103543 |
gaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaggacg |
35103489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 35142138 - 35142212
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| || ||||||||||| | || |||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
35142138 |
ggtggtggtcggggttcgaacctcaaactttgcatatattatgcattgtccatatcaactgagctaagctcacga |
35142212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 60
Target Start/End: Complemental strand, 35224169 - 35224139
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35224169 |
cccggaccttgcatattttatgcattgtccc |
35224139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 39926539 - 39926601
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||| || |||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgtccttatcaactgagctaagctcacga |
39926601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 40187618 - 40187696
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||| ||||||||| || ||||| ||||| | |||||| ||||| |||||||||||||||| | || ||| |||||||| |
|
|
| T |
40187618 |
tttttttggtggtgttcggggtttgaaccgcagaccttacatatattatgcattgtccctaccaactgagttaagctca |
40187696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 40875102 - 40875040
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| | || |||||| ||||||||||| |
|
|
| T |
40875102 |
ggttcgaaccccggacattgcatatattatgcattgtttatgtcaaccgagttaagctcacga |
40875040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 88
Target Start/End: Complemental strand, 43139344 - 43139258
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||| ||||| ||| || ||||| |||||||| |||||||||||||||||||| ||| | ||| | ||| ||||||||||| |||| |
|
|
| T |
43139344 |
tttttttggtagtggtcggggtttgaaccccgtaccttgcatattttatgcatagtctcaatcaagtgagctaagctcacgaggacg |
43139258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 46220948 - 46221017
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||| ||||||||||| || | || ||| ||||||||||||||| |
|
|
| T |
46220948 |
tcagggtttgaacccccgaccttacatattt-atgcattgtccataccaactgagttaagctcacgaagac |
46221017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 10242551 - 10242506
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
10242551 |
gtggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 19578138 - 19578175
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19578138 |
ggtttgaaccccagaccttgcatattttatgcattgtc |
19578175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 19626531 - 19626588
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
19626531 |
gaaccccggaccttgcatatattatgcattgtccaaaccaactgagttaagctcacga |
19626588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 19793600 - 19793543
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |||||| ||||| |||| |||||||| |
|
|
| T |
19793600 |
ttttattggtggtgtttggggttcgaaccccagaccttacatatattatacattgtcc |
19793543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 23198749 - 23198786
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
23198749 |
gggtttgaaccccggactttgcatattttatgcattgt |
23198786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 30397140 - 30397091
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || |||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
30397140 |
gtggtggtcggggttcaaaccccgaaccttacatattttatgcattgtcc |
30397091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 80
Target Start/End: Complemental strand, 39043813 - 39043756
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| || | || ||| |||||||| |
|
|
| T |
39043813 |
ttcgaaccccggacctagcatatattatgcattgtccataccaactgagttaagctca |
39043756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 42336128 - 42336087
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
42336128 |
ttcgaaccccggaccttgcatgtattatgcattgtccttatc |
42336087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 44410661 - 44410620
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| |||||||| |
|
|
| T |
44410661 |
cagggttcgaaccccggaccttgtatatattatacattgtcc |
44410620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 46737840 - 46737807
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
46737840 |
gaaccccggaccttgcatatattatgcattgtcc |
46737807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 4408107 - 4408158
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
4408107 |
ttggtggtg-tctgggttcgaacccgggaccttgcatatatttatgcattgtc |
4408158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 5317303 - 5317355
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||||| ||||||||| ||| |||| || ||| ||||||||||||||| |
|
|
| T |
5317303 |
accttgcatatattatgcattttccatatcaactgagttaagctcacgaagac |
5317355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 5963833 - 5963865
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
5963833 |
gaaccccgaaccttgcatattttatgcattgtc |
5963865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 9021029 - 9021081
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||| | ||| |||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
9021029 |
gtggtggttaggattcgaacctcggaccttacatattttatacattgtcccta |
9021081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 13044157 - 13044205
Alignment:
| Q |
35 |
accttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
13044157 |
accttgcatattttatgcattgtccttaccaactgagctaagctcacga |
13044205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 18023734 - 18023698
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
18023734 |
gaaccctggaccttgcatatattatgcattgtcccta |
18023698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 21050223 - 21050283
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
21050223 |
ggttcgaaacccagaccttgcatatattatgcattgtccttaccaactgagctaagctcac |
21050283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 29237558 - 29237594
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
29237558 |
ggttcgaaccctggaccttgcatatattatgcattgt |
29237594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 35222985 - 35222941
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||| ||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
35222985 |
gggtttgaaccccagaccttgcatatatcatgcattgtccctatc |
35222941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 37624601 - 37624565
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
37624601 |
ttcgaacccccgaccttgcatatattatgcattgtcc |
37624565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 37669340 - 37669392
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
37669340 |
ttggtggtgtttggggttcgaacccaggaccttgcatatatttatgcattgtc |
37669392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 40789181 - 40789130
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
40789181 |
ttggtggtg-tctgggttcgaacccgggaccttgcatatatttatgcattgtc |
40789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 43156194 - 43156142
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
43156194 |
ttggtggtgtttggggttcgaacccgggaccttgcatatatttatgcattgtc |
43156142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 45425532 - 45425476
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||||||| | || ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45425532 |
ttttgttggtggtggccgggattcgaaccccgaaccttgcatatattatgcattgtc |
45425476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 99)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 21400005 - 21400086
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| |||||||||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
21400005 |
atttttttggtggtg-tcagggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaagctcacga |
21400086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 42888636 - 42888574
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || | || ||| |||||||||| |
|
|
| T |
42888636 |
gggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacg |
42888574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 17139499 - 17139580
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| || ||||| ||||||||||||||| |||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
17139499 |
tttttttggtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaagctcacga |
17139580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 8736496 - 8736433
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| || | ||| || ||||||||||| |
|
|
| T |
8736496 |
gggtttgaaccccggaccttgcatattttatgcattgtccataccaaccaagttaagctcacga |
8736433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 11462922 - 11462985
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| | ||||| |||| |||||| |
|
|
| T |
11462922 |
gggttcgaaccccggaccttgcatattttatgcattgtctctagcaaccgaactaagttcacga |
11462985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 41763155 - 41763218
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||| | || ||| ||||||||||| |
|
|
| T |
41763155 |
gggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaagctcacga |
41763218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 89
Target Start/End: Complemental strand, 27533317 - 27533235
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacgt |
89 |
Q |
| |
|
||||||||| || ||||| |||||||| ||||||||||| |||||||||||||||| | || || ||||||||||| ||||| |
|
|
| T |
27533317 |
ttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaagctcacgaggacgt |
27533235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 41973316 - 41973274
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41973316 |
gggttcgaaccccggaccttgcatatattatgcattgtcccta |
41973274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 26256087 - 26256156
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| || |||| || ||| ||||||||||||||| |
|
|
| T |
26256087 |
cagggttcgaaccccggatcttgcatatattatgcattacccttatcaactgagttaagctcacgaagac |
26256156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 17284014 - 17283950
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
17284014 |
cagggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaagctcacg |
17283950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 18091265 - 18091201
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||||||| ||| |||| ||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
18091265 |
gggttcgaaccccggactttgtatatatttatgcattgtccctatcaactgagttaagctcacga |
18091201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 2613783 - 2613720
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
2613783 |
gggttcgaaccccgaaccttacatattttatgcattgtccataccaactgagctaagctcacga |
2613720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 88
Target Start/End: Original strand, 2889939 - 2889994
Alignment:
| Q |
33 |
ggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||||||||||| |||||||||||||||| | || ||| |||||||||||||||| |
|
|
| T |
2889939 |
ggaccttgcatatattatgcattgtccctaccaactgagttaagctcacgaagacg |
2889994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 7550957 - 7550894
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| | |||| || ||| ||||||||||| |
|
|
| T |
7550957 |
gggttcgaatcccggaccttgtatattttatgcattgttcatatcaactgagttaagctcacga |
7550894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 26755676 - 26755609
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||| |||| || ||| ||||||||||| |||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcattgtccatatcaactgagctaagctcacgaggacg |
26755609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 29739397 - 29739330
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || | || ||| |||||| |||| |||| |
|
|
| T |
29739397 |
ggtttgaaccccggaccttgcatattttatgcattgtccttaccaactgagctaagctaacgaggacg |
29739330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 37050990 - 37050955
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37050990 |
gggttcgaaccccggaccttgcatattttatgcatt |
37050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 38448869 - 38448928
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
38448869 |
ttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacg |
38448928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 40227909 - 40227830
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
||||| || |||||| || ||||||||||||| ||||||| |||||||||||||||||| || | || ||| |||||||| |
|
|
| T |
40227909 |
attttttttgtggtggtcggggttcgaaccccagaccttgtatattttatgcattgtccataccaactgagctaagctca |
40227830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 60
Target Start/End: Complemental strand, 50040424 - 50040377
Alignment:
| Q |
13 |
gtgatcagggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| ||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
50040424 |
gtgaccagggtttgaaccctggaccttgcatattttatgcattgtccc |
50040377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 1605456 - 1605418
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcattgtcc |
1605418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 19262907 - 19262969
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||||| |||| || ||| |||||||||| |
|
|
| T |
19262907 |
gggttcgaaccccgaactttgcatatgttatgcattgtccttatcaactgagctaagctcacg |
19262969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 29233974 - 29234012
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29233974 |
gggttcgaaccccagaccttgcatattttatgcattgtc |
29234012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 38862166 - 38862124
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38862166 |
tcagagttcgaaccccagaccttgcatattttatgcattgtcc |
38862124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 7158847 - 7158790
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||| || ||| || ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7158847 |
ttggtggtggtcggggctcaaactccggaccttgcatattttatgcattgtccatatc |
7158790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 10356185 - 10356246
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
10356185 |
gttcgaaccccggaccgtgcatatattatgcattgtccataccaactgagttaagctcacga |
10356246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 15668559 - 15668522
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15668559 |
gggtttgaaccccggaccttgcatattttatgcattgt |
15668522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 16033456 - 16033513
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
16033456 |
gaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacga |
16033513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 16791365 - 16791422
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
16791365 |
tttttttggtggtggttcgggttcgaaccccgaaccttgcatattttatgcgttgtcc |
16791422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 21638192 - 21638111
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||||||||| | ||||||||||| || | | ||| ||||||||||| |
|
|
| T |
21638192 |
tttttttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtccgtaccaattgagctaagctcacga |
21638111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 32944815 - 32944758
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| || ||||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
32944815 |
tttttttggtggtggtcggggttcgaaccccagacgttgcatatattatgcattgtcc |
32944758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 40734995 - 40735044
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| |||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40734995 |
gtggtggtcagggtttgaaccccgaaccttacatattttatgcattgtcc |
40735044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 43545831 - 43545888
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||| ||||||||| || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43545831 |
atttttttggtggtggtcgaggttcgaacccgtgaccttgcatattttatgcattgtc |
43545888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 45481552 - 45481515
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45481552 |
gttcgaaccccggaccttgcatatattatgcattgtcc |
45481515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 4253751 - 4253704
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttat |
50 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
4253751 |
tttttttggtggtggtcagg-ttcgaaccccggaccttgcatattttat |
4253704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 5503746 - 5503802
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||||||| | ||| |||||||| |||||| |||||||||||||||| |
|
|
| T |
5503746 |
atttttttggtggtgatcggagtttgaaccccgaaccttgtatattttatgcattgt |
5503802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 23397325 - 23397361
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23397325 |
gttcgaaccccggaccttgcatatgttatgcattgtc |
23397361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 23405345 - 23405397
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| || || ||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
23405345 |
ttggtggtggtcgggattcgaaccctggaccttgcatatattatgcattgtcc |
23405397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 24752647 - 24752711
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatatt-ttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
24752647 |
gggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaagctcacga |
24752711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 32962635 - 32962587
Alignment:
| Q |
9 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||| || ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
32962635 |
ggtggtggtcggggtttgaaccctggaccttgcatattttatgcattgt |
32962587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 40613081 - 40613045
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40613081 |
ttcgaaccccggaccttgcatatattatgcattgtcc |
40613045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 82
Target Start/End: Original strand, 47528429 - 47528509
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| | ||||||||||| |||||||||| ||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
47528429 |
tttttttggtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaagctcacg |
47528509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Original strand, 2596946 - 2596977
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2596946 |
gaaccccggaccttgcatattttatgcattgt |
2596977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 61
Target Start/End: Original strand, 4968621 - 4968656
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccct |
61 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4968621 |
gaaccccggaccttgcatatattatgcattgtccct |
4968656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 16826402 - 16826347
Alignment:
| Q |
33 |
ggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||||||||||||||||||||||||| || | || ||| ||||||||||| |||| |
|
|
| T |
16826402 |
ggaccttgcatattttatgcattgtccatagcaactgagctaagctcacgaggacg |
16826347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 25533034 - 25532971
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| || | || || ||||||||||| |
|
|
| T |
25533034 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaagctcacga |
25532971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 29800594 - 29800531
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||| ||| || | || ||| ||||||||||| |
|
|
| T |
29800594 |
gggtttgaacccccgaccttgcatattttatgcattatccttaccaactgagttaagctcacga |
29800531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 32561028 - 32560973
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| || | || ||||||||||||| |
|
|
| T |
32561028 |
gaaccccggaccttgcatatattatacattgtccataccaactgagataagctcac |
32560973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 81
Target Start/End: Original strand, 33153870 - 33153941
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||| || ||||| ||||| |||||||| ||||| |||||||||||||||| | || ||| ||||||||| |
|
|
| T |
33153870 |
gtggtgttcggggtttgaacctcggaccttacatatattatgcattgtccctaccaactgagttaagctcac |
33153941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 37045146 - 37045209
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |||| | || ||| | ||||||||| |
|
|
| T |
37045146 |
gggttcgaaccctggaccttgcatatattatgcattgttcctaccaactgagctgagctcacga |
37045209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 48100801 - 48100722
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||| ||| ||||| ||| |||| ||||||| ||||||||||||||||||||||||| || | || ||| ||||||||| |
|
|
| T |
48100801 |
tttttttgatggtggtcaaggtttgaaccccaaaccttgcatattttatgcattgtccataccaactgagctaagctcac |
48100722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 8269358 - 8269436
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||| ||||| ||||||| || | || ||| |||| |||||| |||| |
|
|
| T |
8269358 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaagttcacgaggacg |
8269436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 9639818 - 9639856
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
9639818 |
ggttcgaactccggaccttgcatatattatgcattgtcc |
9639856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 10132445 - 10132483
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
10132445 |
ggttcgaaccccagaccttgcatatattatgcattgtcc |
10132483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Complemental strand, 11702045 - 11701987
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
|||| ||||| ||| |||||||| | |||| ||||||| |||||||||||||||||||| |
|
|
| T |
11702045 |
tttttttggtagtggtcagggtttgcaccctggaccttacatattttatgcattgtccc |
11701987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 12268984 - 12269026
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
12268984 |
gggtttgaaccccggaccttgcatatattatgcattgttccta |
12269026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 14521005 - 14520943
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| || | || ||| |||||||||| |
|
|
| T |
14521005 |
gggttcgaaccccaaactttgcatattttatgcattgtccataccaactgagctaagctcacg |
14520943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 16967200 - 16967262
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||| |||| || || |||||||||||||||| |
|
|
| T |
16967200 |
gaacctcgaaccttgcatatattatgcattgtccatatcaactaagctaagctcacgaagacg |
16967262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 22346740 - 22346702
Alignment:
| Q |
17 |
tcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
22346740 |
tcaggatttgaaccccggaccttgcatattttatgcatt |
22346702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 23981064 - 23981102
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23981064 |
agggttcgaaccccggacattgcatatattatgcattgt |
23981102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 31759894 - 31759960
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||| ||| |||| | ||| ||||||||||||||| |
|
|
| T |
31759894 |
ggttcaaactccggaccttgcatatattatgcattatccatatcaattgagttaagctcacgaagac |
31759960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 60
Target Start/End: Original strand, 32007603 - 32007637
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccc |
60 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32007603 |
gaaccccggaccttgtatattttatgcattgtccc |
32007637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 34521191 - 34521229
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
34521191 |
ggtttgaaccccggaccttgcatatattatgcattgtcc |
34521229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 34766920 - 34766854
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||||| |||||||||| | |||| |||||||| || | || ||| ||||||||||||||| |
|
|
| T |
34766920 |
ggttcgaaccccagaccttgcatgtattatacattgtccataccaactgagttaagctcacgaagac |
34766854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 46040552 - 46040610
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||| ||||||||| | |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
46040552 |
atttttttggtggtgtccggggttcgaacccgggaccttgcatatatttatgcattgtc |
46040610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 2994819 - 2994758
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||||| || || ||||||||||||| |
|
|
| T |
2994819 |
gggtttgaaccccggaccttgcatatattatacattgtccatacgaactgagataagctcac |
2994758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 5280702 - 5280629
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||| ||||||| |||| || | || ||| ||||||||||| |
|
|
| T |
5280702 |
gtggtggtcggggttcgaaccccagaccttgcatatattatgcactgtctcttccaactgagttaagctcacga |
5280629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 5907878 - 5907821
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | ||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
5907878 |
tttttttggtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtcc |
5907821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 6219872 - 6219925
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||| | |||||| ||||||||||| |
|
|
| T |
6219872 |
cccggaccttacatatattatgtattgtccctaccaaccgagttaagctcacga |
6219925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 10293007 - 10292930
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||| || ||||| ||||||| |||| ||||| |||||||||||||||||| || ||| |||||||||| |||| |
|
|
| T |
10293007 |
gtggtggtcggggtttaaaccccgtcccttacatatattatgcattgtccctatcaactgagttaagctcacggagac |
10292930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 13054933 - 13054892
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
13054933 |
ggttcgaacctccgaccttgcatatattatgcattgtcccta |
13054892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 13096966 - 13096918
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || |||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
13096966 |
gtggtggtcggggttcgaaccccg-accttgtatattttatgcattgtcc |
13096918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 17221520 - 17221557
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17221520 |
gggttcgaacctcggaccttgcatatattatgcattgt |
17221557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 17651378 - 17651447
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||| ||||||| |||| || || |||||||||| |||| |
|
|
| T |
17651378 |
cagggtttgaacctcagaccttgcatattttatgtattgtccatatcaacttagttaagctcacggagac |
17651447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 17917128 - 17917205
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||| || ||||| ||| |||| ||||| ||||||||||||||||||| |||| || ||| ||| ||||| ||||| |
|
|
| T |
17917128 |
gtggtggtcggggtttgaatcccgaaccttacatattttatgcattgtccatatcaactgagctaaactcacaaagac |
17917205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 18306080 - 18306019
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccgg-accttgcatattttatgcattgtccct |
61 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
18306080 |
atttttttggtggtgtccagggttcgaaccccgttatcttgcatatattatgcattgtccct |
18306019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 23203383 - 23203346
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
23203383 |
gggtttgaaccccgaaccttgcatattttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 87
Target Start/End: Original strand, 23730366 - 23730447
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| ||||||| || || |||| || ||||| ||||||| ||||| |
|
|
| T |
23730366 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatttatgcgttatctttatcaactgagatcagctcactaagac |
23730447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 32433085 - 32433162
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||| || |||||||||||||| ||||| |||||||||||||| | | |||| || ||| |||||||||| |||| |
|
|
| T |
32433085 |
gtggtggtcggggttcgaaccccgaaccttatatattttatgcatttttcatatcgactgagttaagctcacgcagac |
32433162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 36679645 - 36679588
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||| || ||| |||||||||| |
|
|
| T |
36679645 |
gaaccccggaccttgcatatattatccattgtcccgatcaactgagccaagctcacga |
36679588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 42045354 - 42045435
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| | ||||| |||| || |||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
42045354 |
tttttttggtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaagctcacga |
42045435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 44641582 - 44641525
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| |||| || ||| ||| ||||||| |
|
|
| T |
44641582 |
gaaccccgggccttgcatatattatgcattgtccatatcaactgagctaaactcacga |
44641525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 45003455 - 45003398
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||| || ||| |||||||||| |
|
|
| T |
45003455 |
gaaccccggaccttgcatatattatccattgtcccgatcaactgaggcaagctcacga |
45003398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 86
Target Start/End: Original strand, 48646731 - 48646792
Alignment:
| Q |
26 |
gaaccccggaccttgcatatt-ttatgcattgtccctatctaccgagataagctcacgaaga |
86 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || || ||| |||||||||||||| |
|
|
| T |
48646731 |
gaaccccggaccttgcatattattatgcattgtccatacaaactgagttaagctcacgaaga |
48646792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 49222871 - 49222814
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||| | ||| ||||||||||| |
|
|
| T |
49222871 |
gaaccccggaccttgcatatattgtgcattgttcctatcaattgagttaagctcacga |
49222814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 50638898 - 50638955
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||| ||||||||| | || ||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
50638898 |
ttttgttggtggtggccgggattcgaaccctggaccttgcatatattatgcattgtcc |
50638955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 52267811 - 52267762
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
52267811 |
gaccttgcatattttatgcattgtccttaccaactgagttaagctcacga |
52267762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 3481622 - 3481558
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgca-ttgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||| ||||||||| | || ||| ||||||||||| |
|
|
| T |
3481622 |
gggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaagctcacga |
3481558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 4715559 - 4715595
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4715559 |
ggttcgaaccccaaaccttgcatattttatgcattgt |
4715595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 5033603 - 5033563
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccct |
61 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||| |
|
|
| T |
5033603 |
ggttcgaaccccagaccttgcatatattatgcactgtccct |
5033563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 12364105 - 12364173
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||| || | || ||| ||||||||||| |||| |
|
|
| T |
12364105 |
gggttcgaaccccagactttgcatattttatgcaaggtccataccaactgagctaagctcacgaggacg |
12364173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 15764090 - 15764026
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||| || | || |||||||| |||| ||||| |
|
|
| T |
15764090 |
ttcgaacccctgaccttgtatatattatgcattgtccttaccaactgagataaggtcacaaagac |
15764026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 18166681 - 18166625
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| ||||| ||| || ||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
18166681 |
tttttttggtagtggtcggggtttgaaccccggactttgcatatattatgcattgtc |
18166625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 19620631 - 19620575
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| || | || ||| |||||||||| |
|
|
| T |
19620631 |
gaaccccggaccttgcatatattatgtattgtccttaccaactgagctaagctcacg |
19620575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 24529743 - 24529707
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
24529743 |
ttcgaaccccggaccttacatattttatgcaatgtcc |
24529707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 34877732 - 34877688
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34877732 |
gggtttgaacctcgggccttgcatattttatgcattgtctctatc |
34877688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 36679923 - 36679879
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||| |||||| |
|
|
| T |
36679923 |
gggttcgaaccccggacttggcatattttatgaattgttcctatc |
36679879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 44221061 - 44220985
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| |||| || ||||||||| ||||| || || ||||||||||| |
|
|
| T |
44221061 |
ttggtggtgtccaaggttcgaaccccagaccttgtatatattgtgcattgtctctatcaactaagttaagctcacga |
44220985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Original strand, 44678007 - 44678055
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||| |||| || |||||||| ||||||||||| |||||||||||| |
|
|
| T |
44678007 |
gtggtgaccaggatttgaaccccgaaccttgcatatattatgcattgtc |
44678055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5493 - 5435
Alignment:
| Q |
1 |
attttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| ||||||||| || ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5493 |
atttttttggtggtggtcggggatcgaaccccagaccttgcatattttatgcattgtcc |
5435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 161215 - 161141
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||| || ||||| |||||||| ||||||||||||||||||||||||| || | || ||| ||||||||| |
|
|
| T |
161215 |
ttggtggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccataccaactgagttaagctcac |
161141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 49)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 12841879 - 12841941
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatat-tttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
12841879 |
gttcgaaccccggaccttacatatatttatgcattgtcgctatcaaccgagctaagctcacga |
12841941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 33824941 - 33824875
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| |||| || ||| |||| |||||||||| |
|
|
| T |
33824941 |
ggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaagatcacgaagac |
33824875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 2726407 - 2726456
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtcc |
2726456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 71
Target Start/End: Original strand, 16204772 - 16204841
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgag |
71 |
Q |
| |
|
|||||||||||||| || || || ||||||||||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
16204772 |
ttttattggtggtggtcgggatttgaaccccggaccttgcatacattatgcattgtccatatcaaccgag |
16204841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 19265506 - 19265562
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||| |||||| || |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19265506 |
tttttttggtgatgttcagagtttgaaccccggaccttgcatattttatgcattgtc |
19265562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 4450320 - 4450261
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| || ||| |||||||||| |
|
|
| T |
4450320 |
ttcgaaccccggaccttgcatatattatgcattgtctttatcaactgagctaagctcacg |
4450261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 14 - 57
Target Start/End: Complemental strand, 9111114 - 9111071
Alignment:
| Q |
14 |
tgatcagggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9111114 |
tgatcggggttcgaaccccggaccttgcatatattatgcattgt |
9111071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 28231431 - 28231486
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| || ||| |||||||| |
|
|
| T |
28231431 |
gaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcac |
28231486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 33976305 - 33976266
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33976305 |
gggtttgaaccccggaccttgcatattttatgcattgtcc |
33976266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 655749 - 655787
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
655749 |
gggttcgaaccccggaccttgcatatattatgcattgtc |
655787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 16390489 - 16390427
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
16390489 |
ggtttgaaccccggaccttacatatattatgcattgtccctaccaactgaggtaagctcacga |
16390427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 788937 - 788864
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| |||| ||| ||||||||||| ||||||||||||| || | || ||||||||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttaccaactgagataagctcacga |
788864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 12735241 - 12735306
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| | | || ||| ||||||||||| |
|
|
| T |
12735241 |
cagggtttgaaccccaaaccttgcatattttatgcattgtcccaaccaactgagttaagctcacga |
12735306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 13496195 - 13496114
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| |||||| || || ||||| |||| ||||||||||||||| ||||||||||| | |||| || ||| ||||||||||| |
|
|
| T |
13496195 |
tttttttggtgttggtcggggtttgaactccggaccttgcatatattatgcattgttcatatcaactgagttaagctcacga |
13496114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 14550583 - 14550546
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14550583 |
ggttcgaaccccggactttgcatattttatgcattgtc |
14550546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 18256934 - 18256881
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| || ||| ||||||||||| |
|
|
| T |
18256934 |
cccggaccttgcatatattatgcattgtccttatcaactgagctaagctcacga |
18256881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 26320573 - 26320626
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
26320573 |
cccggaccttgcatattttatgcattgtccataccaactgagctaagctcacga |
26320626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 27834410 - 27834337
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| ||||||| |||||||||||| |||||| ||||||||| | || ||| ||||||||||| |
|
|
| T |
27834410 |
gtggtggtccgggtttgaaccccagaccttgcatatattatgccttgtccctacccactgagttaagctcacga |
27834337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 5937687 - 5937627
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaaga |
86 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | | | || ||| |||||||||||||| |
|
|
| T |
5937687 |
gaaccccggacctttcatattttatgcattgtctcaaccaactgagctaagctcacgaaga |
5937627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 8637436 - 8637504
Alignment:
| Q |
19 |
agggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||| ||||| |||||||||||||| |||||||||||||||| | || || ||||||| ||||||| |
|
|
| T |
8637436 |
agggtttgaacctcggaccttgcatatattatgcattgtccctaccaactgaactaagctcgcgaagac |
8637504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 82
Target Start/End: Original strand, 26489930 - 26490010
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||| ||||||||| | ||||| |||||| |||| ||||||||||||| ||||||||||||| || ||| || ||||||| |
|
|
| T |
26489930 |
tttttttggtggtggttggggtttgaaccctggactttgcatattttatacattgtccctatcaactgagctacgctcacg |
26490010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 247720 - 247681
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
247720 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
247681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 2655027 - 2655094
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
||||| |||||||||| ||| |||||||||||||||||||| | || ||| ||||||||||||||| |
|
|
| T |
2655027 |
gggtttgaaccccggatcttacatattttatgcattgtcccaacaaactgagttaagctcacgaagac |
2655094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 4494871 - 4494934
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| ||| ||||| |||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
4494871 |
gggttcgaatcccagacctcgcatattttatgcattgtccataccaactgagctaagctcacga |
4494934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 8569770 - 8569731
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
8569770 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
8569731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 20744199 - 20744136
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
20744199 |
gggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcacga |
20744136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 8381194 - 8381232
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8381194 |
gggttcgaaccctggaccttgcatatgttatgcattgtc |
8381232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 11012245 - 11012211
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcat |
54 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
11012245 |
gggttcgaaccctggaccttgcatattttatgcat |
11012211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 12232172 - 12232226
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatc |
64 |
Q |
| |
|
|||||| || ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
12232172 |
gtggtggtcggggttcgaaccccagacactgcatatattatgcattgtccctatc |
12232226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 80
Target Start/End: Complemental strand, 21847273 - 21847195
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctca |
80 |
Q |
| |
|
|||| ||||||||| | || ||||||||||| ||||||||||| ||||| |||||||||| | || ||| |||||||| |
|
|
| T |
21847273 |
tttttttggtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctaccaactgagctaagctca |
21847195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 30938452 - 30938390
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
||||||||||||||| || ||||||| ||||||| |||||||| | || ||| |||||||||| |
|
|
| T |
30938452 |
gggttcgaaccccggtccctgcatatattatgcaatgtccctaccaactgagttaagctcacg |
30938390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 2681692 - 2681733
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
2681692 |
cagggtttgaaccccgaaccttgcatatttgatgcattgtcc |
2681733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 9367472 - 9367423
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9367472 |
gtggtggtcggggtttgaatcccagaccttgcatattttatgcattgtcc |
9367423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 9977128 - 9977083
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
9977128 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
9977083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 12808930 - 12808893
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12808930 |
gggttcgaaccccagaccttgcatatattatgcattgt |
12808893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 13376391 - 13376310
Alignment:
| Q |
2 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||| ||||| | ||||||||||||| || | | ||| ||||||||||| |
|
|
| T |
13376391 |
tttttttggtggtggccagggttagaaccccggaccatgcatgtattatgcattgtccataccaattgagctaagctcacga |
13376310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 14429134 - 14429191
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| | | || ||||||| ||||||| |
|
|
| T |
14429134 |
gaaccccggaccttgcatattttatgtattatcccaaccaactgagataaactcacga |
14429191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 18254101 - 18254162
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||||| || | || ||| ||||||||| |
|
|
| T |
18254101 |
gggttcgaatcccggaccttgcatgtattatgcattgtccttaccaactgagctaagctcac |
18254162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 59
Target Start/End: Original strand, 20847521 - 20847550
Alignment:
| Q |
30 |
cccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20847521 |
cccggaccttgcatattttatgcattgtcc |
20847550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 24623307 - 24623384
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||| || ||||| |||||||| ||||| ||||| ||||||||||||| |||| || ||| ||| ||||| ||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtccatatcaactgagctaaactcacaaagac |
24623384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 31971592 - 31971551
Alignment:
| Q |
18 |
cagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
31971592 |
cagggtttgaacctcggaccttgcatatattatgcattgtcc |
31971551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 404224 - 404160
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaa |
84 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||| || | || || |||||||||||| |
|
|
| T |
404224 |
gggttcgaacctcggacattgcatatattatgcattgtccttaccaactaagttaagctcacgaa |
404160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 1918460 - 1918496
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtc |
58 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
1918460 |
gttcgaacctcggaccttgcatatattatgcattgtc |
1918496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 2445373 - 2445297
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||||| || |||||||||||||| | |||| |||| ||||||||||| | |||| || ||| |||||| |||| |
|
|
| T |
2445373 |
ttggtggtggtcggggttcgaaccccgaatcttgtatatattatgcattgttcatatcaactgagttaagcttacga |
2445297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 15062351 - 15062315
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15062351 |
ggttcgaaccccgaaccttacatattttatgcattgt |
15062315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 20720789 - 20720845
Alignment:
| Q |
28 |
accccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaa |
84 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| || | || ||| |||||||||||| |
|
|
| T |
20720789 |
accccggaccttacatatattatgcattgtccataacaactgagctaagctcacgaa |
20720845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 24269937 - 24269881
Alignment:
| Q |
27 |
aaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || || ||| ||||||||||| |
|
|
| T |
24269937 |
aaccccgaaccttgcatattttatgcattgtccatactaactgagctaagctcacga |
24269881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 27907938 - 27907986
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||||||| | ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
27907938 |
ttggtggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 30960054 - 30960114
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||| || | || ||| ||||||||| |
|
|
| T |
30960054 |
ggttcgaaccctggaccttgcatatattaagcattgtccttaccaactgagctaagctcac |
30960114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 53370 - 53443
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| || ||||| ||||||| |||||||||||||||||||||||||||| | || ||| ||||||||||| |
|
|
| T |
53370 |
gtggtggtcggggtttgaaccccagaccttgcatattttatgcattgtcccttccaactgagttaagctcacga |
53443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 185333 - 185261
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||| | ||||| |||||||||| ||||||||||||||||||||||| || | || ||| ||||||||||| |
|
|
| T |
185333 |
tggtgaccggggtttgaaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacga |
185261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 7793 - 7744
Alignment:
| Q |
10 |
gtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7793 |
gtggtggtcggggtttgaacctcggaccttgcatgttttatgcattgtcc |
7744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 1165 - 1224
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctc |
79 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||| | || ||||||||||| |
|
|
| T |
1165 |
gggtttgaaccccggaccttgcatatattatgcattgttcctaccaacggagataagctc |
1224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 31928 - 31983
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcac |
81 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| || ||| |||||||| |
|
|
| T |
31928 |
gaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcac |
31983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 2392 - 2330
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
2392 |
ggtttgaaccccaaaccttgcatatattatgcattgtccctaccaaccgagctaagctcacga |
2330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 25450 - 25388
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
25450 |
gggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagttaagctcacg |
25388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 37593 - 37559
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37593 |
ttcgaaccccggaccttgcatattttatgcattgt |
37559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 88
Target Start/End: Complemental strand, 99092 - 99030
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacgaagacg |
88 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| || ||| |||||||||| |||| |
|
|
| T |
99092 |
gaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggacg |
99030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 14816 - 14853
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14816 |
gggttcaaaccccggaccttgcatattttatgcattgt |
14853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 7451 - 7399
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7451 |
ttggtggtgtttagggttcgaacccgggaccttgcatatatttatgcattgtc |
7399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 4583 - 4635
Alignment:
| Q |
7 |
ttggtggtgatcagggttcgaaccccggaccttgcatat-tttatgcattgtc |
58 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
4583 |
ttggtggtgtttggggttcgaacccgggaccttgcatatatttatgcattgtc |
4635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 34890 - 34950
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacg |
82 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| || | || ||| |||||||||| |
|
|
| T |
34890 |
gttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagttaagctcacg |
34950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 75383 - 75347
Alignment:
| Q |
23 |
ttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
75383 |
ttcgaaccccggaccttgcatatattatgcattgtcc |
75347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 64288 - 64240
Alignment:
| Q |
11 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgtcc |
59 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
64288 |
tggtggtcggggttcgaatcccggaccttgcatatattatgcattgtcc |
64240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 114990 - 114955
Alignment:
| Q |
26 |
gaaccccggaccttgcatattttatgcattgtccct |
61 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
114990 |
gaaccccggaccttgcatattttatgcactgtccct |
114955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1160 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1160
Description:
Target: scaffold1160; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 1712 - 1754
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgtcccta |
62 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
1712 |
gggttcaaacctcgaaccttgcatattttatgcattgtcccta |
1754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 91180 - 91242
Alignment:
| Q |
21 |
ggttcgaaccccggaccttgcatattttatgcattgtccctatctaccgagataagctcacga |
83 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| | || |||||| ||||||||||| |
|
|
| T |
91180 |
ggttcgaaccccggacattgcatatattatgcattgtttatgtcaaccgagttaagctcacga |
91242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 84
Target Start/End: Original strand, 47255 - 47305
Alignment:
| Q |
34 |
gaccttgcatattttatgcattgtccctatctaccgagataagctcacgaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||| || | || ||| |||||||||||| |
|
|
| T |
47255 |
gaccttgcatattttatgcattgtccataccaactgagctaagctcacgaa |
47305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 22972 - 22935
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatattttatgcattgt |
57 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
22972 |
gggtttgaacctcggaccttgcatattttatgcattgt |
22935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 3575 - 3616
Alignment:
| Q |
20 |
gggttcgaaccccggacctt-gcatattttatgcattgtccc |
60 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3575 |
gggtttgaaccccggacctttgcatattttatgcattgtccc |
3616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 36314 - 36281
Alignment:
| Q |
22 |
gttcgaaccccggaccttgcatattttatgcatt |
55 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
36314 |
gttcgaaccccggaccttgcatattctatgcatt |
36281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 75245 - 75177
Alignment:
| Q |
20 |
gggttcgaaccccggaccttgcatatt-ttatgcattgtccctatctaccgagataagctcacgaagac |
87 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||||||| ||| || | || ||| ||||||||||||||| |
|
|
| T |
75245 |
gggttcgaactctggaccttgcatattattatgcattatccataccaactgagttaagctcacgaagac |
75177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University