View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0801_high_6 (Length: 225)

Name: NF0801_high_6
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0801_high_6
NF0801_high_6
[»] chr8 (1 HSPs)
chr8 (5-147)||(28081761-28081903)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 28081761 - 28081903
Alignment:
5 tgttagcttattttagattttagaannnnnnnnnnattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaag 104  Q
    ||||||||||||||||| |||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28081761 tgttagcttattttagaatttagaattttttttttattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaag 28081860  T
105 aaatgtagtagctaaagtgaactatttttgttttatcattatt 147  Q
    |||||||||||||||||||||||||||||||||||||||||||    
28081861 aaatgtagtagctaaagtgaactatttttgttttatcattatt 28081903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University