View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_low_10 (Length: 263)
Name: NF0801_low_10
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0801_low_10 |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0121 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 37 - 101
Target Start/End: Complemental strand, 27709 - 27645
Alignment:
| Q |
37 |
gagggtttgattaaggttaaggagcatttggaaagtgtgcttgtagttgatcatgtggttccatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27709 |
gagggtttgattaaggttaaggagcatttggaaagtgtgcttgtggttgatcatgtggttccatt |
27645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 166
Target Start/End: Complemental strand, 27609 - 27544
Alignment:
| Q |
101 |
tttgatggtgatatgtaaattattggccattggttttttgttttgatgtgattgcaaggaaaagtc |
166 |
Q |
| |
|
|||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27609 |
tttgatagtgatatgttaattattggacattggttttttgttttgatgtgattgcaaggaaaagtc |
27544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University