View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_low_11 (Length: 251)
Name: NF0801_low_11
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0801_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 160 - 241
Target Start/End: Complemental strand, 11034016 - 11033935
Alignment:
Q |
160 |
gcaataactaatttatgtcgaaaaagtcgtagaacacttattgtgaaatttttattaagatacaaaatgtataggagaataa |
241 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
11034016 |
gcaataactaatttatgttgaaaaagtcgtagaaaacttattgtgaaatttttattaagatacaaaatgtataagagaataa |
11033935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 11034303 - 11034259
Alignment:
Q |
55 |
actaaacttgagagctagagtgaaaagtggcaaccctactgatta |
99 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
T |
11034303 |
actaaacttgagagctagagtaaaaagtggcaaccttactgatta |
11034259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 125
Target Start/End: Complemental strand, 11034214 - 11034185
Alignment:
Q |
96 |
attaataaggagaatattttaaaataagaa |
125 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
11034214 |
attaataaggagaatattttaaaataagaa |
11034185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6305 times since January 2019
Visitors: 5767