View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_low_13 (Length: 225)
Name: NF0801_low_13
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0801_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 28081761 - 28081903
Alignment:
| Q |
5 |
tgttagcttattttagattttagaannnnnnnnnnattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaag |
104 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081761 |
tgttagcttattttagaatttagaattttttttttattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaag |
28081860 |
T |
 |
| Q |
105 |
aaatgtagtagctaaagtgaactatttttgttttatcattatt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081861 |
aaatgtagtagctaaagtgaactatttttgttttatcattatt |
28081903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University