View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_low_2 (Length: 406)
Name: NF0801_low_2
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0801_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 187 - 341
Target Start/End: Complemental strand, 40370988 - 40370837
Alignment:
| Q |
187 |
ttttgtaaactagtgtcattgttgaaagtcctttacatacattcatgtgttgttgtgcttgttcctctatgtcactcaataaatgatctaacataaatat |
286 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||||||||| || ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
40370988 |
ttttgtaaactagtgttatttttgaaagtcttttacatacattcatgtgttgt---gcgtgttcctttatgtcactcgataaatgatctaacataaatat |
40370892 |
T |
 |
| Q |
287 |
tttgtatccaactttcatttcttgtataacctttcatgatatgcacataataaca |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40370891 |
tttgtatccaactttcatttcttgtataacctttcatgatatgcacataataaca |
40370837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 101 - 195
Target Start/End: Complemental strand, 40371100 - 40371006
Alignment:
| Q |
101 |
cataccataaataatcttgagaattttaatcatgtttttcttcttttgatgtgaaaaaacataacttatggagatgcaagaaattcttttgtaaa |
195 |
Q |
| |
|
|||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
40371100 |
cataccataaattaacttgagaattttaattatgtttttcttcttttgatgtgaaaaaacataacttatgaagatgcaagaaattattttgtaaa |
40371006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 342
Target Start/End: Complemental strand, 40370713 - 40370679
Alignment:
| Q |
308 |
ttgtataacctttcatgatatgcacataataacac |
342 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
40370713 |
ttgtataacctttcttgatatgcacataataacac |
40370679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University