View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0801_low_5 (Length: 325)
Name: NF0801_low_5
Description: NF0801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0801_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 28081794 - 28082092
Alignment:
Q |
1 |
ttattggctatgtaatatggagttgtagaattagtgaacatcttttcttcatgtctgctggagaaagaaatgtagtagctaaagtgaactatttttgttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28081794 |
ttattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaagaaatgtagtagctaaagtgaactatttttgttt |
28081893 |
T |
 |
Q |
101 |
tatcattatt--ctgtgttgagtgagtgnnnnnnnnnnnnnnngtttctcaattaccataaatgtgaattcaacttgataagttttatggattattgata |
198 |
Q |
|
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28081894 |
tatcattattatctgtgttgagtgagtgtatatatat------gtttctcaattaccataaatgtgaattcaacttgataagttttatggattattgata |
28081987 |
T |
 |
Q |
199 |
tgattatcaactattaaggttatgagatgagtccttcatttctttccaaatcagtttttgtgataccatttgtgtgattcgtatgtgatattggtttgtt |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||| |
|
|
T |
28081988 |
tgattatcaactattaaggttatgagatgagtccttcatttctttccaaatcag-ttttgtgataccatttgtgtgattc--atatgatattggtttgtt |
28082084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University