View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802-Insertion-11 (Length: 302)
Name: NF0802-Insertion-11
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802-Insertion-11 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 302
Target Start/End: Original strand, 9614946 - 9615240
Alignment:
Q |
8 |
gtagatggcactagatttgcaccatccctttttgacatatttccatcgtgtcacttgaaattttaagtaaggttagaaaatgctggctatgttccttctt |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
9614946 |
gtagatggcactagatttgcaccatccctttttgacatatttccatcgtgtcacttgaaattttaagtaaggttaaaaaatgctggctatgttccttctt |
9615045 |
T |
 |
Q |
108 |
tgtttttatggaataccatttgataagtggctatgcttttatgtggtaaagcattatagataccaataatgccttnnnnnnncattactaattcaagtgc |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
T |
9615046 |
tgtttttatggaataccatttgataagtggctatgcttttatgtggtaaagcattatagataccaataatgccttaaaaaaacattactaattgaagtgc |
9615145 |
T |
 |
Q |
208 |
tatgttcttgatgatgtggattccattttcttgatatatagaaattcattggaattgtattgtttgcttcctatgtttagaaagaaaacttttta |
302 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9615146 |
tatgttcttgatgatgtggattccattttcttgatatatagaaattcattggaattgtattgtttgcttcctatgtttagaaagaaaacttttta |
9615240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University