View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802-Insertion-13 (Length: 189)
Name: NF0802-Insertion-13
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802-Insertion-13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 34828648 - 34828524
Alignment:
Q |
8 |
agaaatgcaactatggtgcgcctgagactaatgtgtctgcacgagaagccttggtaatatatctttcatggaaaatgtctgatcttatataaaatcatta |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34828648 |
agaaatgcaactatggtgcgcctgagactaatgtgtctgcacgagaagccttggtaatatatctttcatggaaaatgtctgatcttatataaaatcatta |
34828549 |
T |
 |
Q |
108 |
tattaattgtccttttatctttact |
132 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
34828548 |
tattaattgtccttttatctttact |
34828524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 904 times since January 2019
Visitors: 5820