View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802-Insertion-16 (Length: 58)
Name: NF0802-Insertion-16
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802-Insertion-16 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 34688259 - 34688310
Alignment:
Q |
7 |
aacctgtccctgcaacaatgtgacgtccttctgtgactgcattcccgaccac |
58 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34688259 |
aacctgtccctacaacaatgtgacgtccttctgtgactgcattcccgaccac |
34688310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University