View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_high_2 (Length: 619)
Name: NF0802_high_2
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_high_2 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 2e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 424 - 619
Target Start/End: Complemental strand, 38729995 - 38729800
Alignment:
Q |
424 |
gaggttatgggtacaggcctccccctactatatacgtttctttaattgaatcttatgtcaaatctggaaacttagaaactgcattgaggctctgggacga |
523 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
T |
38729995 |
gaggttatgggtacaggcctccccctactatatatgtttctttgattgaatcttatgtcaaatctggaaagttagaaactgctttgaggctttgggacga |
38729896 |
T |
 |
Q |
524 |
gatgaaattcgcagggttcagaccaaactttggcttgtttacattgatcattgagtcacatgcaaaatcagggaagcttgatattgatatgtctgc |
619 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
38729895 |
gatgaaattagcagggttcagaccaaactttggcttgtatacattgatcattgagtcacatgcaaaatcagggaagcttgatattgctatgtctgc |
38729800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 151; Significance: 1e-79; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 21 - 202
Target Start/End: Original strand, 384776 - 384959
Alignment:
Q |
21 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagtagtat--- |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
384776 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagta-tatctc |
384874 |
T |
 |
Q |
118 |
ctcctgtcttacataaaccaatgtttaggatataataactatcactgttcaactgaaagccctttaatgtgatgtaatggtaaaa |
202 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
T |
384875 |
ctcctgtcttacataaaccaatgattaggatataataactatcactgttcaagtgaaagccctttaatgtgatgtaattgtaaaa |
384959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 295 - 393
Target Start/End: Original strand, 385439 - 385537
Alignment:
Q |
295 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccatgtttttcaaacaaaaataattaccgaggcattctattctgtatagt |
393 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
385439 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccaggtttttcaaacaaaaataattacctaggcattctattctgtatagt |
385537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 417 - 514
Target Start/End: Original strand, 385578 - 385675
Alignment:
Q |
417 |
tttccttgaggttatgggtacaggcctccccctactatatacgtttctttaattgaatcttatgtcaaatctggaaacttagaaactgcattgaggct |
514 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
385578 |
tttccttgaggttatgggtacaggcctccccctactatatacgtttctttgattgaatcttatgtcaaatctggaaagttagaaactgctttgaggct |
385675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 551 - 619
Target Start/End: Original strand, 385674 - 385742
Alignment:
Q |
551 |
ctttggcttgtttacattgatcattgagtcacatgcaaaatcagggaagcttgatattgatatgtctgc |
619 |
Q |
|
|
||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
T |
385674 |
ctttggcttgtatacattgatcatcgagtctcatgcaaaatcagggaagcttgatattgctatgtctgc |
385742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1112 times since January 2019
Visitors: 5826