View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_high_22 (Length: 281)
Name: NF0802_high_22
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 268
Target Start/End: Complemental strand, 15176352 - 15176114
Alignment:
| Q |
30 |
ctatggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtggatggaaatgagattgatttgtcagaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176352 |
ctatggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtggatggaaatgagattgatttgtcagaa |
15176253 |
T |
 |
| Q |
130 |
atgcttcaattcacaactgtcatgaagaaccctttgaaggttcatctaatgcctaggttttagttatttttagaaccaattatccatagataaatcttga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176252 |
atgcttcaattcacaactgtcatgaagaaccctctaaaggttcatctaatatctaggttttagttatttttagaaccaattatccatagataaatcttga |
15176153 |
T |
 |
| Q |
230 |
tttcatgttttgaattgtgttccagattgtatggcccct |
268 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15176152 |
tttcatgtttcgaattgtgttccagattgtatggcccct |
15176114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 26494968 - 26495008
Alignment:
| Q |
55 |
gaatactttgttgccaattttgttttgaattttgagtggaa |
95 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
26494968 |
gaatactttgttgctaatttggttttgaactttgagtggaa |
26495008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University