View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_high_24 (Length: 257)
Name: NF0802_high_24
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 35 - 241
Target Start/End: Original strand, 26983725 - 26983933
Alignment:
| Q |
35 |
attttctgtcatctctgcaacaatactaagatggtacgttattaagatagtattagagttcaatctttgagctttgactctttctgcgttgcattgtttg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26983725 |
attttctgtcatctctgcaacaatactaagatggtacgttattaagatagtattagagttcaatctttgagctttgactctttttgcgttgcattgtttg |
26983824 |
T |
|
| Q |
135 |
catgaagtacataaattaaggacacgcttaaccacac--atatgggaattgaaatacgtgaattaagttcaactccatgtccgtgaaacctattaaagtt |
232 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26983825 |
catgaagtacataaattaagtacacgcttaaccacacatatatgggaattgaaatacgtgaattaagttcaactccatgtccgtgaaacctattaaagtt |
26983924 |
T |
|
| Q |
233 |
caagttcat |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
26983925 |
caagttcat |
26983933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 226
Target Start/End: Complemental strand, 26983146 - 26983064
Alignment:
| Q |
133 |
tgcatgaagtacataaattaaggacacgcttaaccacacatatgggaattgaaatacgtgaattaagttcaactccatgtccgtgaaacctatt |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26983146 |
tgcatgaagtacataaattaagttcacgcttaaccacac--atgagaattgaaatac---------gttcaactccatgtccgtgaaacctatt |
26983064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1017 times since January 2019
Visitors: 5823