View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_high_25 (Length: 252)
Name: NF0802_high_25
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 39300166 - 39300375
Alignment:
Q |
13 |
aatatctccaatggcttttcctgcatgatctttgttcatttcaccaccttgtaatgcttcaatgctaccatgtggtggttccttgtctaccactgtaagt |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39300166 |
aatatctccaatggcttttcctgcatgatctttgttcatttcaccaccttgtaatgcttcaatgctaccatgtggtggttccttgtctaccactgtaagt |
39300265 |
T |
 |
Q |
113 |
tgttcaaaatgagttgtcatctttgggactctgtctttttcaacatgaatatctctctcgtttgtggtgttttctctgcgagacaattgttcagatgcca |
212 |
Q |
|
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39300266 |
tgttcaaaatgggtagtcatctttgggactctgtctttttcaacatgaatatctctctcgtttgtggtgttttctctgcgagacaattgttcagatgcca |
39300365 |
T |
 |
Q |
213 |
ttttgtgtgt |
222 |
Q |
|
|
|||||||||| |
|
|
T |
39300366 |
ttttgtgtgt |
39300375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University