View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_high_27 (Length: 251)
Name: NF0802_high_27
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 9223380 - 9223289
Alignment:
Q |
151 |
aaatgatgatgacgaattaacgatgataattatatatgccgtgtgttttgaacgtaatcgaaattgactttcaatgaccttgtaagtataat |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
T |
9223380 |
aaatgatgatgacgaattaacgatgataattatatatgccgtgtgtgttgaacgtaatcgaaattgactttcaacgaccttgtaagaataat |
9223289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 9223449 - 9223390
Alignment:
Q |
24 |
gaactaagtaataaactttatttggatttatcaaaataaaaatgtcaaattacaatatta |
83 |
Q |
|
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
T |
9223449 |
gaactaagtaataaactttatttggattaatgaaaataaaaatgtcaaattacaatatta |
9223390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University