View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_13 (Length: 494)
Name: NF0802_low_13
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_low_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 467; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 1 - 494
Target Start/End: Complemental strand, 43090248 - 43089754
Alignment:
| Q |
1 |
ttcttcaagtaccaaatggaatccttctcttcctcatcctccttctcaagatttctcaaagagagattcgagaggcttgtgtcatcatccagctaccata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43090248 |
ttcttcaagtaccaaatggaatccttctcttcctcatcctccttctcaagatttctcaaagagagattcgagaggcttgtgtcataatccagctaccata |
43090149 |
T |
|
| Q |
101 |
cctcccaacctttcacctgcagaagctgcttgggatcaatccttctactcagaaactgagaaggagcaaaacaagcacgccattgcggtagcagctgcaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090148 |
cctcccaacatttcacctgcagaagctgcttgggttcaatccttctactcagaaactgagaaggagcaaaacaagcacgccattgcggtagcagctgcaa |
43090049 |
T |
|
| Q |
201 |
cagcagcagccgcagatgctactgtggcagctgctcaagctgccgtgg-ctgtggttagattaaccagccacggcagagacaccatgtttggtggtggac |
299 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090048 |
cagcagcagccgcagatgctgctgtggcagctgctcaagctgccgtgggctgtggttagattaaccagccacggcagagacaccatgtttggtggtggac |
43089949 |
T |
|
| Q |
300 |
accagaaatttgctgctgtcaagattcaaaccacatttaggggttacttggtaagtttgattcacttttctttaattaattatgtgattttactaatgca |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089948 |
accagaaatttgctgctgtcaagattcaaacaacatttaggggttacttggtaagtttgattcacttttctttaattaattatgtgattttactaatgca |
43089849 |
T |
|
| Q |
400 |
gttctaagaaaaacagattttgctcaaattgaactagtcagattcaaattctaggctttttatgttttaaagtattattatagcttcaattagaa |
494 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089848 |
gttctaagaaaaacagattttgctcaaattgaactagtcagattcaaattctaggctttttatgttttaaagtattattatagcttcaattagaa |
43089754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1201 times since January 2019
Visitors: 5828