View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0802_low_37 (Length: 308)

Name: NF0802_low_37
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0802_low_37
NF0802_low_37
[»] chr1 (2 HSPs)
chr1 (105-158)||(38932854-38932907)
chr1 (7-40)||(38932782-38932815)


Alignment Details
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 105 - 158
Target Start/End: Original strand, 38932854 - 38932907
Alignment:
105 gcggtaactgtaatattgacaggaattagttgaagagccgccaaatgatgatgt 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38932854 gcggtaactgtaatattgacaggaattagttgaagagccgccaaatgatgatgt 38932907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 38932782 - 38932815
Alignment:
7 attgtcgtgtgagcaaggaaaattcggtgtctat 40  Q
    ||||||||||||||||||||||||||||||||||    
38932782 attgtcgtgtgagcaaggaaaattcggtgtctat 38932815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University