View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_37 (Length: 308)
Name: NF0802_low_37
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 105 - 158
Target Start/End: Original strand, 38932854 - 38932907
Alignment:
Q |
105 |
gcggtaactgtaatattgacaggaattagttgaagagccgccaaatgatgatgt |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38932854 |
gcggtaactgtaatattgacaggaattagttgaagagccgccaaatgatgatgt |
38932907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 38932782 - 38932815
Alignment:
Q |
7 |
attgtcgtgtgagcaaggaaaattcggtgtctat |
40 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
38932782 |
attgtcgtgtgagcaaggaaaattcggtgtctat |
38932815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University