View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0802_low_39 (Length: 296)

Name: NF0802_low_39
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0802_low_39
NF0802_low_39
[»] chr8 (2 HSPs)
chr8 (1-96)||(7247289-7247384)
chr8 (1-87)||(25321379-25321465)
[»] scaffold0070 (1 HSPs)
scaffold0070 (1-87)||(18418-18505)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 7247289 - 7247384
Alignment:
1 tgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttggttttgctgt 96  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7247289 tgtctctgacatcttttacacaaattcataaactaatgtacaaagaaaaaattaaatgcaaatgcatgttagtccatgcacctttggttttgctgt 7247384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 25321465 - 25321379
Alignment:
1 tgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg 87  Q
    ||||||| |||||||||||| |||||||  ||  |||||||||| ||||| | || |||||||||||||| |||||| |||||||||    
25321465 tgtctctaacatcttttacaaaaattcactaataaatgtacaaataaaaactaaatttcaaatgcatgttggtccattcacctttgg 25321379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 18418 - 18505
Alignment:
1 tgtctctgacatctttt-acagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg 87  Q
    |||| |||||||||||| ||| ||||||| ||   |||||||||||||||| | || |||||||||||||| |||||| |||||||||    
18418 tgtcactgacatctttttacaaaaattcacaaggaaatgtacaaagaaaaactaaatttcaaatgcatgttggtccattcacctttgg 18505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 949 times since January 2019
Visitors: 5821