View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0802_low_46 (Length: 268)

Name: NF0802_low_46
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0802_low_46
NF0802_low_46
[»] chr7 (1 HSPs)
chr7 (55-235)||(25624462-25624642)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 25624642 - 25624462
Alignment:
55 gactaattattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgattgtaac 154  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25624642 gactaatcattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgtttgtaac 25624543  T
155 agtgagtttagcaaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc 235  Q
     ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25624542 ggtgagtttagcgaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc 25624462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University