View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_46 (Length: 268)
Name: NF0802_low_46
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 25624642 - 25624462
Alignment:
Q |
55 |
gactaattattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgattgtaac |
154 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
25624642 |
gactaatcattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgtttgtaac |
25624543 |
T |
 |
Q |
155 |
agtgagtttagcaaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc |
235 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25624542 |
ggtgagtttagcgaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc |
25624462 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University