View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_47 (Length: 262)
Name: NF0802_low_47
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0802_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 35107767 - 35108004
Alignment:
Q |
1 |
aaagtatgcttatagatatctgtctggatgtagttaaatgcgtttcttttttgaaa-gctaaaaacgtcattaatactatggtgaccagaccagttgagc |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35107767 |
aaagtatgcttatagatatctgtctggatgtagttaaatgcgtttcttttttgaaaagctaaaaacgtcattaatactatggtgaccagaccagttgagc |
35107866 |
T |
 |
Q |
100 |
acaagttgtgccaagtttatgctgcatacacttgggtgtacagcaagcaactatcactt-gggtttaca-acatccgaacactaaacataaattgtattc |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
T |
35107867 |
acaagttgtgccaagtttatgctgcatacacttgggtgtacagcaagcaactatcacttggggtttacacacatctgaacactaaacataaattgtattc |
35107966 |
T |
 |
Q |
198 |
ggtagcattatactcatctacaataatagcaggtaaat |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
35107967 |
ggtagcattatactcatctacaataatagcaggtaaat |
35108004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 210 times since January 2019
Visitors: 5833